ID: 1028202214

View in Genome Browser
Species Human (GRCh38)
Location 7:87975044-87975066
Sequence ATGTTACCTCACATGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2696
Summary {0: 1, 1: 16, 2: 168, 3: 630, 4: 1881}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028202214_1028202221 17 Left 1028202214 7:87975044-87975066 CCTTTTTCCATGTGAGGTAACAT 0: 1
1: 16
2: 168
3: 630
4: 1881
Right 1028202221 7:87975084-87975106 ATTAGGGTGTAGGCATATTTAGG 0: 1
1: 3
2: 8
3: 87
4: 478
1028202214_1028202222 18 Left 1028202214 7:87975044-87975066 CCTTTTTCCATGTGAGGTAACAT 0: 1
1: 16
2: 168
3: 630
4: 1881
Right 1028202222 7:87975085-87975107 TTAGGGTGTAGGCATATTTAGGG No data
1028202214_1028202223 19 Left 1028202214 7:87975044-87975066 CCTTTTTCCATGTGAGGTAACAT 0: 1
1: 16
2: 168
3: 630
4: 1881
Right 1028202223 7:87975086-87975108 TAGGGTGTAGGCATATTTAGGGG No data
1028202214_1028202217 -8 Left 1028202214 7:87975044-87975066 CCTTTTTCCATGTGAGGTAACAT 0: 1
1: 16
2: 168
3: 630
4: 1881
Right 1028202217 7:87975059-87975081 GGTAACATGTTCGTAGGTTCTGG 0: 1
1: 3
2: 22
3: 109
4: 324
1028202214_1028202219 1 Left 1028202214 7:87975044-87975066 CCTTTTTCCATGTGAGGTAACAT 0: 1
1: 16
2: 168
3: 630
4: 1881
Right 1028202219 7:87975068-87975090 TTCGTAGGTTCTGGATATTAGGG No data
1028202214_1028202218 0 Left 1028202214 7:87975044-87975066 CCTTTTTCCATGTGAGGTAACAT 0: 1
1: 16
2: 168
3: 630
4: 1881
Right 1028202218 7:87975067-87975089 GTTCGTAGGTTCTGGATATTAGG 0: 1
1: 0
2: 2
3: 66
4: 364
1028202214_1028202220 7 Left 1028202214 7:87975044-87975066 CCTTTTTCCATGTGAGGTAACAT 0: 1
1: 16
2: 168
3: 630
4: 1881
Right 1028202220 7:87975074-87975096 GGTTCTGGATATTAGGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028202214 Original CRISPR ATGTTACCTCACATGGAAAA AGG (reversed) Intronic
Too many off-targets to display for this crispr