ID: 1028207662

View in Genome Browser
Species Human (GRCh38)
Location 7:88034819-88034841
Sequence AGGGAGAGCACAGCAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 3, 1: 9, 2: 62, 3: 137, 4: 359}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028207662_1028207670 26 Left 1028207662 7:88034819-88034841 CCCACAATTGCTGTGCTCTCCCT 0: 3
1: 9
2: 62
3: 137
4: 359
Right 1028207670 7:88034868-88034890 GTGCCATGAGGCTGCTGCTGGGG 0: 1
1: 3
2: 11
3: 80
4: 386
1028207662_1028207669 25 Left 1028207662 7:88034819-88034841 CCCACAATTGCTGTGCTCTCCCT 0: 3
1: 9
2: 62
3: 137
4: 359
Right 1028207669 7:88034867-88034889 TGTGCCATGAGGCTGCTGCTGGG No data
1028207662_1028207668 24 Left 1028207662 7:88034819-88034841 CCCACAATTGCTGTGCTCTCCCT 0: 3
1: 9
2: 62
3: 137
4: 359
Right 1028207668 7:88034866-88034888 CTGTGCCATGAGGCTGCTGCTGG No data
1028207662_1028207667 14 Left 1028207662 7:88034819-88034841 CCCACAATTGCTGTGCTCTCCCT 0: 3
1: 9
2: 62
3: 137
4: 359
Right 1028207667 7:88034856-88034878 GTTTCTCTCTCTGTGCCATGAGG 0: 1
1: 7
2: 27
3: 114
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028207662 Original CRISPR AGGGAGAGCACAGCAATTGT GGG (reversed) Intronic