ID: 1028207662

View in Genome Browser
Species Human (GRCh38)
Location 7:88034819-88034841
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 3, 1: 9, 2: 62, 3: 137, 4: 359}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028207662_1028207670 26 Left 1028207662 7:88034819-88034841 CCCACAATTGCTGTGCTCTCCCT 0: 3
1: 9
2: 62
3: 137
4: 359
Right 1028207670 7:88034868-88034890 GTGCCATGAGGCTGCTGCTGGGG 0: 1
1: 3
2: 11
3: 80
4: 386
1028207662_1028207667 14 Left 1028207662 7:88034819-88034841 CCCACAATTGCTGTGCTCTCCCT 0: 3
1: 9
2: 62
3: 137
4: 359
Right 1028207667 7:88034856-88034878 GTTTCTCTCTCTGTGCCATGAGG 0: 1
1: 7
2: 27
3: 114
4: 596
1028207662_1028207668 24 Left 1028207662 7:88034819-88034841 CCCACAATTGCTGTGCTCTCCCT 0: 3
1: 9
2: 62
3: 137
4: 359
Right 1028207668 7:88034866-88034888 CTGTGCCATGAGGCTGCTGCTGG No data
1028207662_1028207669 25 Left 1028207662 7:88034819-88034841 CCCACAATTGCTGTGCTCTCCCT 0: 3
1: 9
2: 62
3: 137
4: 359
Right 1028207669 7:88034867-88034889 TGTGCCATGAGGCTGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028207662 Original CRISPR AGGGAGAGCACAGCAATTGT GGG (reversed) Intronic
903829523 1:26166096-26166118 AGGGAGAACCCAGCATTAGTGGG - Intergenic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
906935213 1:50208665-50208687 AGGGAGAGCACAGGAATAAGAGG + Intergenic
907795165 1:57708733-57708755 AGAGAGAGCAAAGCAAGAGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910066005 1:83151510-83151532 AGGGAGATCACTGCAAGTGAAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911236732 1:95420182-95420204 AGGGGGAGCAGAGCAGTTGTTGG + Intergenic
912181764 1:107227234-107227256 AGTGAGGGCTCAGCAAATGTTGG + Intronic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919001633 1:191839191-191839213 AGGGAGAGGAGAGCGATGGTGGG + Intergenic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
919262521 1:195215819-195215841 AGGGAGAGCACAGATAATTTAGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
922139286 1:222866131-222866153 AGGGTGAGCAGAGGAACTGTTGG + Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922789096 1:228300196-228300218 TGGGAGAGCACAGAACATGTGGG - Intronic
923247489 1:232146641-232146663 GGGGAGAGCACTGCATTTGGAGG + Intergenic
923645757 1:235818972-235818994 AGGGGGAGAACAGCAATCTTGGG - Intronic
1062926120 10:1316672-1316694 GGGGAGGGCACAGCAATAGAGGG - Intronic
1062929890 10:1345683-1345705 AGGGACAGGACAAGAATTGTAGG + Intronic
1064446466 10:15398348-15398370 AGGGAGAGTGAAGCAATTGGAGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066143104 10:32527214-32527236 AGGGAGAGCACAACAGTGGGGGG - Intronic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069914722 10:71780389-71780411 AGGGTGAAGGCAGCAATTGTAGG + Intronic
1070505818 10:77111792-77111814 TTAGAGAGCACAGCCATTGTGGG - Intronic
1071935635 10:90527061-90527083 AGGGAGAGTACAGGATTTGTGGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1073104245 10:101023234-101023256 TGGGAGAGCAGAGCTATTGGAGG + Intronic
1073870789 10:107861868-107861890 AGGGAGAGCTCAGCAGCTTTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074687774 10:115975730-115975752 AGGGAGGCCAGAGCATTTGTGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075568823 10:123523897-123523919 AGGAAGAGCTCAGCAAATGGTGG + Intergenic
1077842471 11:5990657-5990679 AGGGAGGGCACAGAAAGAGTGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079369149 11:19835419-19835441 AGTGAGAAGACAGCAGTTGTAGG + Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080115530 11:28617591-28617613 AGGAAGAGGAAAGCCATTGTAGG - Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1080857116 11:36121875-36121897 AGGGAGGGCACTGCAATGGCTGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082802488 11:57425189-57425211 AGGAAGAGAAGAGCAATTTTAGG + Intronic
1083512887 11:63227935-63227957 AGGAAGAGCACAGCAATTACGGG - Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083953583 11:65970552-65970574 GGGGAGGGCACAGCAGCTGTGGG + Intronic
1084045785 11:66567109-66567131 AGGGAGAGCTCAGGAATTATGGG + Intronic
1084110266 11:67009752-67009774 AAGGAGAGTCCAGCTATTGTGGG + Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085223332 11:74895259-74895281 ATGGAGAGCACAGCAACCGAGGG + Intronic
1085459427 11:76684592-76684614 AGGGAGAGCACAGCAACAAGGGG - Intergenic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086249837 11:84799327-84799349 AGGAAGAGCACAGCAGCTGGAGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087032136 11:93716282-93716304 AAGGAGAGCTCAGCCATTCTGGG - Intronic
1088009722 11:104985679-104985701 AGGGAGAGTACAGCATCTGAGGG + Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090801079 11:130172711-130172733 AGGAAGAGGACAGCAATGGCCGG - Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093581730 12:20791194-20791216 AGGGAAAGAACAGCAACTGGGGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095196362 12:39323266-39323288 CAGGAGAGCACAGTAAATGTTGG - Intronic
1096860258 12:54521479-54521501 AGTGAGAGCACAGATTTTGTTGG - Intronic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1099024395 12:77447602-77447624 AGGGAGAACAAAGCAATTGCAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099764263 12:86961627-86961649 AGGGAGAACACAGCATTTGGGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1101552027 12:105772193-105772215 GGGAAGAGCTCAGCGATTGTTGG - Intergenic
1103124989 12:118414060-118414082 ATGGAAAGCACAGCAATCTTGGG - Intronic
1106423765 13:29606165-29606187 AGAGGGAGGACAGCAATTGCAGG - Intergenic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107524317 13:41214709-41214731 AGGGAAAGCACAGCAATTTTGGG - Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107871697 13:44752467-44752489 AGTGACAGCTCAGCAAATGTTGG + Intergenic
1107932894 13:45320993-45321015 AGAGAGAGCACACTAAGTGTTGG + Intergenic
1109203828 13:59459912-59459934 GGGGAAGGCACAGCAATTGCAGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110277955 13:73660922-73660944 TGAGAGGGCACAGAAATTGTGGG + Intergenic
1110620281 13:77586747-77586769 AGAGACAGCACAGCATTTGGAGG + Intronic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111750496 13:92325423-92325445 AGGAATAACACAGCAACTGTGGG - Intronic
1112710884 13:102127930-102127952 AGTGGGAGCAGAGCAAGTGTAGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113602830 13:111582862-111582884 AGGGAAAGCACAGCAGCTGGGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116489938 14:45493316-45493338 AGGGAAAGCACAGCAATTTGAGG - Intergenic
1116504906 14:45665908-45665930 AGGAAGAACACAGCAATTGTGGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118956532 14:70488219-70488241 AGAGAGAGCACAACAATTGGAGG + Intergenic
1121831214 14:97053880-97053902 AGGGATAGGAGAGCAATTGCTGG + Intergenic
1122909608 14:104820940-104820962 AGGCAGAGCACAGCACTGGGCGG + Intergenic
1123794049 15:23753803-23753825 AGTGAGAGCAAAGCCATTATGGG - Intergenic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1125429703 15:39581993-39582015 AGGGAGAGGACAGCACGTGAGGG - Intronic
1125920124 15:43520419-43520441 AAGGAGAGGACAGCCAGTGTGGG + Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129247717 15:74289925-74289947 AGGGAGAGCAGAGCAAGGGAAGG - Intronic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130062206 15:80578175-80578197 AGGGAGAGCACAGCAGCAGGAGG + Intronic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131302986 15:91216122-91216144 GGGGCGAGTGCAGCAATTGTTGG + Intronic
1137549036 16:49424230-49424252 AGAGAGAACACAGCAATGGCAGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139239399 16:65375469-65375491 TGGGTGAGCACAGCTAGTGTTGG - Intergenic
1142761608 17:2045412-2045434 AGGTAGAGCCCAGCAGTAGTAGG + Intergenic
1142762984 17:2052144-2052166 AGGGAGAGCCCATGACTTGTGGG + Intergenic
1143062726 17:4216195-4216217 AGGGAAAACACAGCAATAGGTGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1148129095 17:45252334-45252356 AGGTAGAGCACAGAATTTTTAGG + Intergenic
1149092919 17:52805211-52805233 AGGGAGCGCACAACAACTGAAGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149570684 17:57670204-57670226 AGGGACAACACAGAAATTATTGG + Intronic
1149623275 17:58061833-58061855 AGGCAGAGCAGAGGAATTCTCGG + Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150764475 17:67992828-67992850 AGGGTGAGAACAGCAAGGGTTGG - Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151850190 17:76685415-76685437 AGGCAGAGCACTGCAGATGTTGG - Intronic
1152805992 17:82356592-82356614 TGGGGCAGCACAGCCATTGTGGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153429702 18:5002641-5002663 AGTGAGAGCACACAAATTATAGG + Intergenic
1153904430 18:9648666-9648688 AGTAAGAGCTCAGCAAATGTTGG - Intergenic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1154955933 18:21254645-21254667 AGGAAGGGCACTGCAATTCTTGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1158116742 18:54004658-54004680 AGGCAGAGCACAGCTATTAAGGG + Intergenic
1159775443 18:72598856-72598878 AGAGAGAGTGCAGCAATTTTGGG - Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160196008 18:76756002-76756024 GGGGAGAGCACTGCACATGTGGG + Intergenic
1160548193 18:79675952-79675974 AGGGGAAGGACAGCAGTTGTAGG - Intergenic
1160885234 19:1343345-1343367 AGGCAGAGCACAGGATTTCTAGG + Intergenic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
926299276 2:11590472-11590494 AGGGAAGGAACAGCAAGTGTGGG - Intronic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927196625 2:20552144-20552166 AGGCAGAGCCCAGCAAGGGTGGG - Intergenic
928131978 2:28658488-28658510 GGAGAGAGAACAGCAAATGTGGG + Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928495741 2:31829723-31829745 AGGGAGAGTGCTGCAATTGGAGG - Intergenic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
930042168 2:47134332-47134354 AGGGAGAACACAGGATTTTTAGG - Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931760347 2:65411314-65411336 AGGGATATCACAGCAATGTTAGG - Intronic
931816604 2:65909394-65909416 TGGGAGAGAAAACCAATTGTTGG + Intergenic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
935447775 2:103174878-103174900 AGGGAGGCCTCAGCACTTGTGGG + Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
940461489 2:153968382-153968404 AGGGACAGCAAAGGAAGTGTGGG - Intronic
940469403 2:154076087-154076109 AGGGAGAGCAGAGCTGCTGTTGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941528352 2:166633025-166633047 AGGGAGAGCCCAGCAATTCTGGG - Intergenic
941595579 2:167472712-167472734 AGGAAGAGCACAGCAAGCGGAGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942391893 2:175503362-175503384 AGGGACAGCATAGCAATTGGTGG - Intergenic
942454078 2:176125605-176125627 TGGGTGAGCACAGCATTTGCAGG + Intergenic
942842966 2:180386097-180386119 AGATAGAGAACACCAATTGTTGG - Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943779621 2:191808817-191808839 AAGGAGGCCACAGCAGTTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944046046 2:195413426-195413448 AGGAAGAGCACAGCAATCGTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945058206 2:205886228-205886250 TGGGAGAGCACAGCATTTTCTGG - Intergenic
945529116 2:210927685-210927707 AGTGAGAGCACAGCACGTGCAGG - Intergenic
946196302 2:218034600-218034622 AGGCAGAGCACAGCCAGGGTGGG + Intergenic
947389400 2:229623606-229623628 AGGAAGAAGACAGAAATTGTTGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947627800 2:231631659-231631681 AGGGAGAGAACAGCCATAGAGGG + Intergenic
948477260 2:238227983-238228005 AGGGAAAGCCCAGCAAAAGTGGG + Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169782889 20:9328125-9328147 AGGGAGAGTACATCAAATGAGGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1173891158 20:46511706-46511728 AGGCAGAGCACAGTAATTACAGG - Intronic
1176411746 21:6452856-6452878 AGGGAGAGCCCAACGATTATGGG + Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177212768 21:18091042-18091064 AGGGAAAGCACAGCACCTGGGGG + Intronic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1178051060 21:28747804-28747826 AGGATGAGCACTGCAATTGAAGG + Intergenic
1178051216 21:28749718-28749740 AGGATGAGCACTGCAATTGAAGG + Intergenic
1179687240 21:43061178-43061200 AGGGAGAGCCCAACGATTATGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181116751 22:20636315-20636337 AGCGATAGCACAGCACATGTGGG + Intergenic
1181860844 22:25816958-25816980 AGCAACAGCACAGCTATTGTTGG + Intronic
1183393438 22:37559052-37559074 AGGGACAGCACAGCAAAGGCTGG - Intergenic
1183726465 22:39592685-39592707 AGGGGGAGCACAGGATTTCTGGG - Intronic
1185034360 22:48463840-48463862 AGGGAGAGGACAGCTGTTGGTGG - Intergenic
950414061 3:12858330-12858352 AGAGAGAGCAAAAGAATTGTGGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951495166 3:23317388-23317410 ACGGAGAGCACACCAACTGTGGG - Intronic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953829437 3:46282814-46282836 AGGGAGAGGATGGCAGTTGTTGG + Intergenic
954030925 3:47819417-47819439 GAAGAGAGCACAGCACTTGTGGG - Intronic
954861908 3:53697253-53697275 TGGGCGATCCCAGCAATTGTGGG + Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
956790503 3:72676588-72676610 AGGCAGAGCACATCTGTTGTGGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957977087 3:87460578-87460600 AGGGACAGAAAAGTAATTGTAGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959409150 3:105998399-105998421 AGGGACAGCACAGCAACTCTGGG - Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960564811 3:119122244-119122266 AGAGAGAACACAGCAATTTGGGG + Intronic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961715918 3:128857385-128857407 ATGGTGAACACAGCATTTGTAGG - Intergenic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
961778955 3:129310261-129310283 GGGAAAAGCACAGCAATTGCAGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964432078 3:156617817-156617839 GGGCAGAGCACAGGAATTGTTGG + Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965322379 3:167265893-167265915 AGGGAGAGCACATCAACTAGAGG - Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966437474 3:179904848-179904870 AGGGACAGCACAGCAGCAGTAGG - Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968005120 3:195237362-195237384 AAGGAGAGTGCAGCAGTTGTGGG - Intronic
968017908 3:195356193-195356215 GGAAAGAGCACAGCAACTGTGGG + Intronic
968480665 4:831739-831761 AGGGAGAACACGGCCATTGGGGG + Intergenic
968500322 4:946939-946961 AGGGAGAGCACGGCCCCTGTAGG + Intronic
968716713 4:2165437-2165459 AGGCAGAGCACAGGATTTTTAGG + Intronic
968968436 4:3781205-3781227 AGGGAGAGAACAGAAATGGAGGG + Intergenic
972090614 4:35277234-35277256 AGACATAGGACAGCAATTGTGGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972479763 4:39486216-39486238 ATGGTGAACACAGCATTTGTAGG + Intergenic
972784196 4:42311834-42311856 ATGGAGTGCAAAGGAATTGTGGG - Intergenic
973169468 4:47121265-47121287 AAGAAAAGCACAGCAATTGTGGG - Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
976030147 4:80741995-80742017 ATGGAGAGCACAGCAAATGGGGG - Intronic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976523468 4:86058328-86058350 AGGGGGAGGACAGCATCTGTGGG - Intronic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977381120 4:96274851-96274873 AGAGAGACCACAGCAACTGTGGG - Intergenic
977414318 4:96712159-96712181 AGGGAAAGCAAAGCAATGCTTGG + Intergenic
977521740 4:98093745-98093767 AGGCAAAGCACAGCAATTGGGGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981384667 4:144115500-144115522 TGTGACAGCACTGCAATTGTGGG - Intronic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981629321 4:146800187-146800209 AGAGGGAACACAGCAAATGTAGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984871318 4:184327761-184327783 AGGAAGAACACAGCAAATGCTGG + Intergenic
984883397 4:184429459-184429481 GGGCAGAGCAAAGCAGTTGTGGG + Intronic
985830960 5:2229497-2229519 AGGCAGAGGACAGCAAGTCTTGG - Intergenic
985863836 5:2495814-2495836 AAGAATAGAACAGCAATTGTTGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986155912 5:5175813-5175835 AGGGAGAGAACAGCGATCATGGG - Intronic
987347730 5:16993450-16993472 AGGCAGAGCTAAGAAATTGTAGG + Intergenic
987537289 5:19205968-19205990 AGGAAGAACACAGCGATTGCAGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988274631 5:29065140-29065162 AAGGAGGGCACTGCATTTGTGGG - Intergenic
988868507 5:35361741-35361763 AGGGAGATGACAGCAATGGGAGG + Intergenic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992257263 5:74933441-74933463 AGGGAGAGCACAGGAAATCGGGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
995557426 5:113344123-113344145 AGGGAAAGCACAGCAAGTGGGGG + Intronic
995836344 5:116403258-116403280 AGTGAAAGCACAGCAATGGTGGG - Intronic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996827634 5:127703347-127703369 AGGGACAGCAGAGCAATAGCAGG + Intergenic
997250758 5:132386943-132386965 AGGTAGAGCACAGCCATAGGTGG - Intronic
997607503 5:135185639-135185661 AGGCAGAGCCCAGCAGCTGTGGG + Intronic
997627865 5:135343179-135343201 AGTGAGAGCACCACAATTATGGG + Exonic
998498517 5:142611928-142611950 AGGAACAGCACAGCACGTGTTGG - Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
998751352 5:145324896-145324918 AGGGAAAGCAAAGTATTTGTAGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1002570164 5:180135679-180135701 TGGGAGAGCAAAGCAGGTGTGGG + Intronic
1002958230 6:1889437-1889459 AGGGAGAGCAGTGAAGTTGTTGG - Intronic
1004185178 6:13415373-13415395 AGGGAGGGCACTGCCATTATGGG + Intronic
1006979704 6:38137175-38137197 AGAGTGAGCTCAGCAAGTGTAGG + Intronic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1007626280 6:43247948-43247970 AGGGAGAGTACAGAAATCGGGGG + Intronic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008775769 6:55035745-55035767 AGGGAGAGCAGAGGAATTTTTGG - Intergenic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1010922455 6:81700545-81700567 AGAGAGAGAACAGCAGTTGGTGG - Intronic
1011102965 6:83744386-83744408 AGGGAGAGGGCAGCAATGGGGGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1011522017 6:88218064-88218086 CTGGAAAGCACAGCAATTGCAGG + Intergenic
1012783124 6:103589062-103589084 AGGGAAAGCGCAGCAATAGTGGG - Intergenic
1012807207 6:103909168-103909190 AAAGAGAGCACAGCAACTGAAGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013466220 6:110419194-110419216 ATGGAGAGCACAGCAAGAGGGGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1014832643 6:126121060-126121082 GGGGAGATCACACCAATTGGGGG - Intergenic
1014840902 6:126219007-126219029 AGGGAAAGCATAACAATTGTGGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015907173 6:138129277-138129299 AGGGAGAGCGCAGTAGTTTTGGG + Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021640864 7:22735055-22735077 AAGGAGAACACATCAATTGTGGG + Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022760100 7:33339611-33339633 AGGGTGATCTCAGCAATTCTAGG + Intronic
1023085260 7:36564029-36564051 AGGCAGATCACAGCTACTGTGGG - Intronic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1026419660 7:70221002-70221024 AGGCAGAGCCCAGCAGTTGCAGG - Intronic
1027278104 7:76583265-76583287 AGGGAGATCACTGCAAGTGAAGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028850590 7:95533175-95533197 AGGGAGAGGCCTGCAATTTTAGG + Intronic
1029647868 7:101869522-101869544 GGGGTGAGCACAGCATTTGCGGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1032971909 7:137174567-137174589 AGGGAGAGCACAGAAATGTGAGG + Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1035138980 7:156738175-156738197 AGGGAGAGCACAACAAATGGGGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035705362 8:1670564-1670586 AGGGAGTGCTCAGTAAATGTTGG + Intronic
1036522561 8:9505496-9505518 AGGGAGAGGCCAGTAATTTTAGG - Intergenic
1036814934 8:11895015-11895037 AAGGAGAGCACAGCAATCGCGGG - Intergenic
1038863039 8:31408577-31408599 AGGAACTGCACAGCAACTGTGGG - Intergenic
1040290280 8:46120655-46120677 AATGAGACCACAGCGATTGTTGG - Intergenic
1040295980 8:46149304-46149326 GGGGAGATCACAGGAAATGTTGG - Intergenic
1040721103 8:50324270-50324292 AGGAAGAGCACAGCAACTGAGGG - Intronic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041582960 8:59483845-59483867 AGAGAGAGCATAGCAACTGGGGG - Intergenic
1043066871 8:75583680-75583702 AGGGAGAACACAGGATTTTTAGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043226919 8:77745201-77745223 AGGGAGGGTACAGAAATTGGAGG + Intergenic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044616212 8:94144993-94145015 AGGCTGAGCACAGCAAGTGCTGG + Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046552843 8:115738606-115738628 AGAGAGAGCAAAACACTTGTGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047050795 8:121110393-121110415 AGACAGAGCTGAGCAATTGTCGG - Intergenic
1047273495 8:123386034-123386056 AAGGAGAAAATAGCAATTGTTGG + Intronic
1047352540 8:124089311-124089333 AGGAAGAACACAATAATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049879043 8:145049523-145049545 AGGGGCTGCACAGTAATTGTAGG - Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052258900 9:26491793-26491815 AGGGAGAACACAGCAGTTGTGGG - Intergenic
1053288784 9:36866524-36866546 AGGAAGAGCACAACAAAAGTTGG + Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055220204 9:73920062-73920084 AGGGAAAGCACAGCAAATACAGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057528882 9:95826748-95826770 AAGGAGAGCAAAGAAATTGGAGG - Intergenic
1057624870 9:96668059-96668081 AGGTAGAGCACAGGAACAGTGGG + Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059117594 9:111613554-111613576 AGGGAGCTCACAGGCATTGTGGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062272614 9:135716801-135716823 AGAGAGAGCAGGGCACTTGTGGG - Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185832988 X:3319314-3319336 AGGCAAAGGACAGCAAATGTGGG + Intronic
1187053144 X:15714145-15714167 AGGGAGAGAACAGCTATTACAGG - Intronic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188911368 X:35851798-35851820 AGGGGGAGCTAAGAAATTGTTGG - Intergenic
1188943167 X:36264556-36264578 AGGAGAAGCATAGCAATTGTGGG - Intronic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188973266 X:36642555-36642577 AGGAAAAGCAAAGCAACTGTGGG - Intergenic
1188974538 X:36657399-36657421 TGGGAGAGCACAGCTATGCTAGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189884959 X:45533123-45533145 GGGGAGAGTACAGCAATTGGAGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1190797382 X:53758251-53758273 AGTGAGCGCACAGCAAGTGCAGG - Intergenic
1190913187 X:54790431-54790453 AGTGAGTGCACAGCAAGTGCAGG - Intronic
1191586876 X:62837073-62837095 AGGCAGAGAATAGCAAGTGTTGG + Intergenic
1192065289 X:67878842-67878864 AGAGAGAACACAAAAATTGTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192418534 X:71007195-71007217 CGTGAGAGCACATGAATTGTCGG - Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193802349 X:85951912-85951934 AGTGAGAGCATAGCAACTGGGGG + Intronic
1193856825 X:86612604-86612626 AGGGAAAGCATAGCTATTATGGG - Intronic
1193912137 X:87318258-87318280 AGCGAAAGAACAGCAATTGTGGG - Intergenic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195823204 X:108969769-108969791 AGAGAAAGTGCAGCAATTGTGGG + Intergenic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196510217 X:116500280-116500302 AGAGAGAGCACTGCAACTGGGGG - Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197435761 X:126425959-126425981 AGGGAGAAAACAGCAATTATGGG - Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198278062 X:135116200-135116222 AGGGAGAGTGCAGCAAGTGGGGG - Intergenic
1198292900 X:135256316-135256338 AGGGAGAGTGCAGCAAGTGGGGG + Intronic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198854889 X:141005433-141005455 AGCAAGAGCAGAGCAGTTGTGGG + Intergenic
1198877123 X:141239710-141239732 AGCAAGAGCAGAGCAGTTGTGGG - Intergenic
1198907804 X:141581936-141581958 AGCAAGAGCAGAGCAGTTGTGGG - Intergenic
1198908987 X:141592488-141592510 AGCAAGAGCAGAGCAGTTGTGGG + Intronic
1198918091 X:141695664-141695686 AGCAAGAGCAGAGCAGTTGTGGG - Intronic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199595976 X:149505980-149506002 ACAGAGAGAGCAGCAATTGTGGG + Intronic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1201858879 Y:18573521-18573543 ATGGTAAGCACAGCATTTGTAGG - Intronic
1201874443 Y:18746860-18746882 ATGGTAAGCACAGCATTTGTAGG + Intronic