ID: 1028208242

View in Genome Browser
Species Human (GRCh38)
Location 7:88041231-88041253
Sequence GGGGGTATACACCTTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028208225_1028208242 26 Left 1028208225 7:88041182-88041204 CCCATCGTATTTACAGTCCCACC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1028208242 7:88041231-88041253 GGGGGTATACACCTTGGGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1028208233_1028208242 5 Left 1028208233 7:88041203-88041225 CCAATATTCAAGGGGAAGGAATT 0: 1
1: 4
2: 34
3: 142
4: 622
Right 1028208242 7:88041231-88041253 GGGGGTATACACCTTGGGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1028208226_1028208242 25 Left 1028208226 7:88041183-88041205 CCATCGTATTTACAGTCCCACCA 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1028208242 7:88041231-88041253 GGGGGTATACACCTTGGGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1028208230_1028208242 9 Left 1028208230 7:88041199-88041221 CCCACCAATATTCAAGGGGAAGG 0: 1
1: 1
2: 12
3: 83
4: 371
Right 1028208242 7:88041231-88041253 GGGGGTATACACCTTGGGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1028208232_1028208242 8 Left 1028208232 7:88041200-88041222 CCACCAATATTCAAGGGGAAGGA 0: 1
1: 0
2: 5
3: 41
4: 214
Right 1028208242 7:88041231-88041253 GGGGGTATACACCTTGGGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028208242 Original CRISPR GGGGGTATACACCTTGGGGT GGG Intronic
900534637 1:3170801-3170823 GGGGGTTTGCATCATGGGGTGGG - Intronic
903223044 1:21879521-21879543 GGGGGAAGAGCCCTTGGGGTGGG - Intronic
903765983 1:25734561-25734583 GGGGGTGTCCACCCTGGGCTAGG + Intronic
906334923 1:44920892-44920914 GTGGGTATATACCTAGGAGTGGG + Intronic
908396987 1:63734673-63734695 GGGGGTATACACCTAGCAATAGG + Intergenic
908700934 1:66899112-66899134 GGGTATATACACCTAGGAGTAGG + Intronic
912782708 1:112566961-112566983 TTGGGTATATACCTTGGAGTAGG + Intronic
916807534 1:168273243-168273265 GGGGGTATATACCTAGAAGTGGG + Intergenic
917751568 1:178058184-178058206 GGGGTTAGAAACCTTGGGGGTGG - Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
924293342 1:242560961-242560983 GGGCATATACACCTGGGGGCTGG - Intergenic
1071108852 10:82130544-82130566 GGGGGTATATACCTAGCAGTGGG + Intronic
1074699957 10:116084070-116084092 GGGGGCAGAGGCCTTGGGGTGGG - Intronic
1079507102 11:21165560-21165582 TCAGGTATACACCTAGGGGTGGG - Intronic
1084186011 11:67471824-67471846 GGGAGAATTCCCCTTGGGGTAGG + Intergenic
1085187513 11:74589032-74589054 TGGGCTATATACCCTGGGGTTGG - Intronic
1087624238 11:100578635-100578657 GGTGGTATTCACCATGGGGAGGG - Intergenic
1089755518 11:120683381-120683403 GGGAGGAGAGACCTTGGGGTAGG + Intronic
1090236885 11:125154777-125154799 GTGAGAATACACCTGGGGGTGGG + Intergenic
1091096342 11:132825805-132825827 AAGGGAATACACCTTTGGGTTGG + Intronic
1092841325 12:12544463-12544485 TTGGGTATACACCTAGGAGTGGG + Intronic
1095680291 12:44966865-44966887 GGGGGTATATACCTAGCAGTTGG - Intergenic
1104536564 12:129622932-129622954 GGGGGAATACAAATTGGGGCTGG + Intronic
1110078511 13:71280902-71280924 GGGGGTATATACCTAGCAGTAGG + Intergenic
1120999414 14:90440721-90440743 GAGGGCATACATCTTGGGGCTGG + Intergenic
1121077337 14:91080294-91080316 GTGGGTATACACCTAGAAGTAGG + Intronic
1122343624 14:101044723-101044745 GGTGGTATTGACCTTGGGGAAGG + Intergenic
1124640839 15:31395499-31395521 TCGGGTATACACCTAGGAGTGGG + Intronic
1128284503 15:66425122-66425144 GTGAGTATAGACCTTGGGTTTGG + Intronic
1131465441 15:92651274-92651296 TGGGGTGTACACCTGGGAGTGGG - Intronic
1136127649 16:28196108-28196130 AGGGTTATAGACCTTGGGGTAGG - Intronic
1140916080 16:79494558-79494580 GAGGTTATAGACCTTGAGGTGGG - Intergenic
1142291211 16:89194400-89194422 GGGGGTGTACACCTTGGCTGGGG - Intronic
1143420324 17:6785991-6786013 TGGGGTATACACCTAGCAGTGGG - Intronic
1143899009 17:10159297-10159319 TTGGGTATTCACCTAGGGGTAGG - Intronic
1144700716 17:17337000-17337022 AGGGGTATATACCTAGGAGTGGG + Intronic
1149264159 17:54909366-54909388 TGGGGTAGTCACCTTGGTGTAGG + Intronic
1150539697 17:66084298-66084320 TGGAGTATATACCTTGGAGTGGG - Intronic
1150696123 17:67407015-67407037 TGGGATATATACCTAGGGGTGGG + Intronic
1153266440 18:3274952-3274974 GGGGGTATATACCTAGCAGTGGG - Intronic
1154343367 18:13523130-13523152 GGGTGTGCACATCTTGGGGTGGG - Intronic
1156441819 18:37197836-37197858 TTGGGTAGACATCTTGGGGTGGG - Intronic
1158025997 18:52898185-52898207 TGGGGGACAGACCTTGGGGTTGG - Intronic
1158489117 18:57894321-57894343 GTGGGTATATATTTTGGGGTGGG - Intergenic
1158629268 18:59098038-59098060 TGGGGTATAGACCTAGGAGTGGG - Intergenic
1161946007 19:7437511-7437533 GGAGTTATAAACCATGGGGTGGG - Intronic
1166995218 19:46716803-46716825 GGGGGAATTCACCTTGGGGGTGG + Exonic
1167041775 19:47027102-47027124 GGGGGCAAGCACCATGGGGTGGG - Intronic
929016225 2:37498806-37498828 GGGGGTATACTGGTTGGGGCTGG - Intergenic
929760616 2:44802986-44803008 GCGGGTATAAACCTAGGGATGGG - Intergenic
932073333 2:68642895-68642917 GGGGTTACATACCTTGGAGTGGG + Intergenic
932331325 2:70900048-70900070 GTGGGTATAAATCTAGGGGTTGG + Intergenic
933572182 2:84026611-84026633 GGAGATGTTCACCTTGGGGTAGG + Intergenic
935114728 2:100125684-100125706 GGGGGTGGTCACCTTGGGGAGGG + Intronic
936526406 2:113244558-113244580 GGGGGTGGCCACCTTGGGCTTGG + Exonic
937295651 2:120808322-120808344 GGGGGTAAACACCTAATGGTGGG - Intronic
939648150 2:144727464-144727486 TGGGGTAAATACCTTGGAGTGGG - Intergenic
944518010 2:200531765-200531787 CTGGGAATACACCTTGAGGTGGG - Intronic
946363129 2:219231310-219231332 GAGGGTAAAAGCCTTGGGGTCGG - Intronic
947448399 2:230182519-230182541 AGGGGGATTCACTTTGGGGTTGG + Intronic
1171422738 20:25029506-25029528 GGGGGTATATACCTATGAGTGGG - Intronic
1171849662 20:30299539-30299561 GGGGGGATACTCCTTGGGCCTGG - Intergenic
1172293759 20:33793500-33793522 GCGTGCAAACACCTTGGGGTGGG + Intergenic
1175457002 20:59123194-59123216 GGGGGTAGCCACATGGGGGTGGG - Intergenic
1178021585 21:28414598-28414620 GGGGGTATATACCTAGCAGTAGG - Intergenic
1180663616 22:17491217-17491239 TGGGGTGTACACCTAGGAGTTGG + Intronic
1181093709 22:20491958-20491980 TGGGGTATACACCTTGGCTGTGG - Intronic
1182492912 22:30685458-30685480 GTGGGCAGGCACCTTGGGGTTGG + Intergenic
1183364571 22:37400208-37400230 GGGGGTAGACACGAGGGGGTGGG - Intronic
1184451054 22:44583103-44583125 GTGGGGGTCCACCTTGGGGTGGG - Intergenic
1185049044 22:48544145-48544167 TGGGGTGTGCACCCTGGGGTGGG + Intronic
949996211 3:9619395-9619417 GGGACTATTCACCTTTGGGTGGG + Intergenic
950376423 3:12576020-12576042 TTGGGTATACACCTGGGCGTGGG + Intronic
952242415 3:31546126-31546148 TGGGGTATATACCTGGGAGTGGG + Intronic
953755654 3:45643711-45643733 GGGGGTGCCCACCTTGGGGATGG + Intronic
955359205 3:58258555-58258577 GGGGATGTACACCATGGGGGTGG - Intronic
961364029 3:126388222-126388244 TGGGGTGGACACCTTGGGTTAGG + Intergenic
961829935 3:129618271-129618293 TGGGGGACACACATTGGGGTGGG - Intergenic
963056107 3:141187582-141187604 GGTGTTATCCATCTTGGGGTGGG - Intergenic
964398453 3:156272852-156272874 GGTAGTATACACCATGGGCTTGG - Intronic
972884308 4:43466508-43466530 GGGGGTATACACCCAGCAGTGGG + Intergenic
975165052 4:71168958-71168980 GGGGGTATATACCTAGGAGTGGG + Intergenic
986209085 5:5653240-5653262 AGGGGTATATGCCTAGGGGTGGG + Intergenic
991285311 5:64968371-64968393 GGGGGTAAATACCTAGGAGTGGG - Intronic
997426041 5:133803422-133803444 GGAGGTATATCCCTGGGGGTTGG - Intergenic
999238412 5:150113647-150113669 GGGGGCCTAGACCTTGGGCTTGG - Intergenic
1000877514 5:166659158-166659180 GGGGATATAAACATTGGTGTAGG - Intergenic
1001518986 5:172377345-172377367 AGGGTTATACCCATTGGGGTTGG - Intronic
1003119206 6:3306233-3306255 GGGGGTGGACCCCTTGGGCTTGG - Intronic
1004704776 6:18114288-18114310 GGGTGTATATACCTAGGAGTGGG - Intergenic
1009038774 6:58151972-58151994 GGGGGTATATACCTAGCAGTGGG + Intergenic
1010920547 6:81674606-81674628 TTGGGTATACACCTAGGAGTGGG - Intronic
1011070756 6:83380227-83380249 GAGGGCATTCAACTTGGGGTAGG + Intronic
1012313473 6:97756525-97756547 GGAGGTATACAAATTGGGTTGGG + Intergenic
1012576346 6:100804890-100804912 GGGGGTATATACCTAGTGATAGG - Intronic
1015172917 6:130274474-130274496 TGGGGTATACAGCTTAGGGTGGG + Intronic
1018999011 6:168731294-168731316 GGGGGTATATACCTAGCAGTGGG - Intergenic
1023371456 7:39516254-39516276 GGGTGTGTACACCAGGGGGTAGG + Intergenic
1027404755 7:77848210-77848232 TGGGGTATATACCTAGGAGTGGG + Intronic
1027945943 7:84746397-84746419 AGAGGTATAAACCTTGGGGGTGG + Intergenic
1028208242 7:88041231-88041253 GGGGGTATACACCTTGGGGTGGG + Intronic
1029448515 7:100627809-100627831 GGGAGAATCCACCTGGGGGTTGG + Exonic
1029954451 7:104622811-104622833 GTGGGTATATACCTAGGAGTGGG + Intronic
1033627936 7:143129206-143129228 TGGCGAATACACCTTTGGGTGGG - Intergenic
1037369012 8:18153452-18153474 GGGGATATATACCCTGGAGTAGG - Intergenic
1037762725 8:21752590-21752612 GGGGGTATAAATCTGGGGGTTGG - Intronic
1039794311 8:40898978-40899000 GGGGGTATATACCTAGCAGTGGG - Intergenic
1040912405 8:52532545-52532567 GTGGGTTTTAACCTTGGGGTGGG - Intergenic
1053292165 9:36888253-36888275 TGGGGTGTACACCTAGGAGTGGG - Intronic
1057298798 9:93864743-93864765 AGGAGTATTCACCTAGGGGTGGG + Intergenic
1057886351 9:98832964-98832986 TTGGGTATACACCTAGGAGTGGG + Intronic
1061513631 9:131075983-131076005 GTGGGTAGAAACTTTGGGGTTGG + Intronic
1062295906 9:135826442-135826464 GGGGGTACACACCCAGGGGTGGG - Intronic
1187793067 X:22971771-22971793 GGGGGTATATATCTAGGAGTGGG - Intergenic
1187819299 X:23269478-23269500 GGCAGTAAACACCTTGGCGTGGG - Intergenic
1188076725 X:25785849-25785871 GGGGTTATAGAGCCTGGGGTAGG + Intergenic
1194251923 X:91586634-91586656 TGGGGTATATACCTAGAGGTGGG - Intergenic
1194611741 X:96053009-96053031 TGGGGTATATACCTAGTGGTAGG + Intergenic
1197776084 X:130119573-130119595 GGGAGGAGACACCTTGGGGAGGG + Intergenic
1200570853 Y:4827872-4827894 TGGGGTATATACCTAGAGGTGGG - Intergenic
1202069470 Y:20975783-20975805 GGGGGTTTAAACCTAGGTGTTGG + Intergenic