ID: 1028208247

View in Genome Browser
Species Human (GRCh38)
Location 7:88041242-88041264
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028208232_1028208247 19 Left 1028208232 7:88041200-88041222 CCACCAATATTCAAGGGGAAGGA 0: 1
1: 0
2: 5
3: 41
4: 214
Right 1028208247 7:88041242-88041264 CCTTGGGGTGGGAATCTTGGGGG No data
1028208233_1028208247 16 Left 1028208233 7:88041203-88041225 CCAATATTCAAGGGGAAGGAATT 0: 1
1: 4
2: 34
3: 142
4: 622
Right 1028208247 7:88041242-88041264 CCTTGGGGTGGGAATCTTGGGGG No data
1028208230_1028208247 20 Left 1028208230 7:88041199-88041221 CCCACCAATATTCAAGGGGAAGG 0: 1
1: 1
2: 12
3: 83
4: 371
Right 1028208247 7:88041242-88041264 CCTTGGGGTGGGAATCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr