ID: 1028208307

View in Genome Browser
Species Human (GRCh38)
Location 7:88042299-88042321
Sequence TGTTAGCTAGAGCATCTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028208304_1028208307 24 Left 1028208304 7:88042252-88042274 CCATTTTGCAGAGGGTTTGAAAA 0: 1
1: 0
2: 0
3: 16
4: 286
Right 1028208307 7:88042299-88042321 TGTTAGCTAGAGCATCTTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028208307 Original CRISPR TGTTAGCTAGAGCATCTTGT AGG Intronic
904885097 1:33731425-33731447 TTTTAGCGAGAATATCTTGTAGG - Intronic
911524742 1:98971007-98971029 TGTTTATTAGAGCATCTTATTGG - Intronic
911935385 1:103963183-103963205 CGTAAGGTAGAGCATTTTGTTGG + Intergenic
914925830 1:151885924-151885946 TGTTACCTGTAGCATCTTGAAGG + Intronic
915783919 1:158586702-158586724 AAATAGCTAGAGCATATTGTAGG - Intergenic
918136979 1:181682329-181682351 TTCTAGTTAGAGCATCTTGGAGG - Intronic
919568627 1:199219447-199219469 TGTTATCTCGTACATCTTGTAGG + Intergenic
920890637 1:209981957-209981979 TGTTTTCTATAGTATCTTGTAGG + Intronic
924388689 1:243526424-243526446 TGTCTGCTAGACCATCTTATTGG - Intronic
1067905756 10:50288984-50289006 TGTAAACTAGAGCAGCTTCTAGG + Intergenic
1067914809 10:50385945-50385967 TGCTTGCTAGACCCTCTTGTGGG + Intronic
1070100953 10:73386286-73386308 TTTTAGCCATAGAATCTTGTTGG + Intronic
1071507425 10:86241135-86241157 TGGGAGCTGGTGCATCTTGTGGG - Intronic
1073457693 10:103647481-103647503 GTGGAGCTAGAGCATCTTGTTGG - Intronic
1074635108 10:115305808-115305830 TGTCAGCTAGAGGATGTTGCTGG + Intronic
1075267901 10:121020703-121020725 AGTTAGATAGAGCATCCTGTTGG + Intergenic
1075430656 10:122377776-122377798 TGTTTGCTTAAGCATCTTCTAGG - Intronic
1080043823 11:27787610-27787632 TGTTTGCTACAGCATCTGGGTGG - Intergenic
1081004380 11:37716568-37716590 TGATAGCAACAGCATCTTTTAGG - Intergenic
1085731611 11:79004075-79004097 GGATAGCTAGATCTTCTTGTTGG - Intronic
1089253413 11:117180974-117180996 TGTTAACTAGAGCTTCCTGCTGG + Intronic
1089448669 11:118574474-118574496 TGTTAGTTATAGAATCTAGTTGG - Intronic
1094227557 12:28062955-28062977 TCTTAGATAGAGCATCTTTATGG + Intergenic
1094403723 12:30091659-30091681 TCCTAGCTTGAGTATCTTGTAGG - Intergenic
1094704104 12:32897589-32897611 TCTTCTCTAGAGCCTCTTGTTGG - Intergenic
1096216774 12:49802133-49802155 TGGTAGCTATAGCATCTTCTAGG + Intronic
1102032542 12:109750806-109750828 TGTTTGCTTGAGGATTTTGTAGG + Intronic
1104714841 12:131009464-131009486 TGTGCATTAGAGCATCTTGTAGG + Intronic
1110155527 13:72312225-72312247 TGATAGGAAGAGCATCTTTTGGG - Intergenic
1111393776 13:87635535-87635557 CTTTATCTAGAGAATCTTGTTGG - Intergenic
1113980939 13:114275107-114275129 TCTTTGCTAGAGCATCTAGATGG + Intergenic
1120648688 14:87104022-87104044 TGTTTTCTATAGCATCTTCTTGG + Intergenic
1127164920 15:56234578-56234600 CATTAACTAAAGCATCTTGTTGG + Intronic
1130977162 15:88785459-88785481 TGTTAGGTTGAGGATCTGGTGGG + Intergenic
1140809287 16:78561705-78561727 TGTTAGGTAGAGCGCCTTATAGG + Intronic
1142377986 16:89716773-89716795 TGCTAGCTTCAGCATCTTGGAGG + Exonic
1144577366 17:16437504-16437526 TGTCAGCTAGGGCATTCTGTGGG - Intergenic
1146735896 17:35238708-35238730 TAATAAATAGAGCATCTTGTGGG + Intergenic
1146845040 17:36177093-36177115 TTCTAGCTAGAGGATCCTGTGGG + Intronic
1146857347 17:36265028-36265050 TTCTAGCTAGAGGATCCTGTGGG + Intronic
1146863272 17:36323347-36323369 TTCTAGCTAGAGGATCCTGTGGG - Intronic
1146873259 17:36388938-36388960 TTCTAGCTAGAGGATCCTGTGGG + Intronic
1146880614 17:36440024-36440046 TTCTAGCTAGAGGATCCTGTGGG + Intergenic
1147066132 17:37923935-37923957 TTCTAGCTAGAGGATCCTGTGGG - Intergenic
1147076139 17:37989563-37989585 TTCTAGCTAGAGGATCCTGTGGG + Intronic
1147077664 17:38003496-38003518 TTCTAGCTAGAGGATCCTGTGGG - Intronic
1147087664 17:38069109-38069131 TTCTAGCTAGAGGATCCTGTGGG + Intergenic
1147093600 17:38127430-38127452 TTCTAGCTAGAGGATCCTGTGGG - Intergenic
1147103606 17:38193058-38193080 TTCTAGCTAGAGGATCCTGTGGG + Intergenic
1148510834 17:48168277-48168299 TGCTAGCCATAGCATCTTTTGGG + Intronic
1148622096 17:49042418-49042440 TCTTAGCAACAGCAGCTTGTGGG + Intronic
1149861986 17:60126945-60126967 TTCTAGCTAGAGGATCCTGTGGG - Intergenic
1150636873 17:66919160-66919182 TGTTAGCTAGTCCATGTTGTAGG - Intergenic
1152259148 17:79257393-79257415 TGCTAGTCAGAGCATCTTTTTGG - Intronic
1153153343 18:2120942-2120964 TGTTAGCAAAAGCAGCATGTAGG + Intergenic
1156591699 18:38497040-38497062 TGTCCGCTAGAGCATCTTATAGG + Intergenic
1161733159 19:5974639-5974661 TGTTGTGTAAAGCATCTTGTTGG - Intronic
1166337308 19:42116265-42116287 TTTTTGAAAGAGCATCTTGTTGG + Intronic
926259949 2:11250647-11250669 TTTTAGCTAGAGCAACTAGAAGG - Intronic
927766706 2:25816567-25816589 TGTTAGCTAGACTTTGTTGTAGG - Intronic
931847731 2:66222120-66222142 TGGAAGCTAGAGCATCTATTTGG + Intergenic
932210003 2:69919743-69919765 TGTTAACTATAGTATCCTGTTGG + Intronic
932439327 2:71722001-71722023 TGTTAGAAAGAGGATCTTCTTGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933386033 2:81611336-81611358 CTTTAGCTAAATCATCTTGTTGG - Intergenic
940015970 2:149104399-149104421 TGTTAGCTATTTTATCTTGTGGG + Intronic
940679235 2:156763248-156763270 TGTTCTCTAGTGCCTCTTGTTGG - Intergenic
943050367 2:182906588-182906610 TGTTTGCAATAGCCTCTTGTAGG - Intergenic
1168843016 20:921773-921795 TGTCAGCTGGAGCAACTTGCAGG + Intergenic
1172107145 20:32523542-32523564 TATTAACTAGAGCATCTGCTAGG - Intronic
1173432674 20:43004415-43004437 TATTAGTTAGATAATCTTGTGGG - Intronic
1175049604 20:56142483-56142505 TATTTGGTAGAGCATCTGGTAGG + Intergenic
1176173916 20:63708748-63708770 TGTCAGGAAGAGCAGCTTGTTGG + Exonic
1177106235 21:16958818-16958840 AGCTAGCTAGAGCATTTTGAAGG - Intergenic
1183888777 22:40907663-40907685 GGTTAGCTTCACCATCTTGTTGG + Intronic
1184591023 22:45483397-45483419 TGGTAGCCAGACCATTTTGTTGG - Intergenic
950243362 3:11392125-11392147 TGTGGGCTAGAGCAACTTCTAGG + Intronic
950653341 3:14421685-14421707 TGATACCTACATCATCTTGTAGG + Intronic
952055792 3:29443891-29443913 TCTTAGCTTGAGCATCTTGAGGG + Intronic
953509317 3:43519414-43519436 TCTTAGTTAGAGTATCTTGAGGG - Intronic
953953568 3:47212484-47212506 TGTTGGCTAGAGCACCACGTTGG + Intergenic
961146823 3:124600989-124601011 AGTAAGCTAGAGCTTTTTGTGGG + Intronic
963615266 3:147528676-147528698 TGCTGGCTAAAGCATTTTGTTGG + Intergenic
966011959 3:175089314-175089336 TGTTAGCAAATGCATCTTATTGG - Intronic
966664887 3:182461120-182461142 GGTAAGGTAGAGCCTCTTGTAGG + Intergenic
972111348 4:35563241-35563263 TGTGAGCTAAATCATCTTTTTGG + Intergenic
980914131 4:139018559-139018581 TTTTAGCTTCAGCAGCTTGTTGG + Intronic
981702923 4:147626916-147626938 TTATAGCTAGAGCATGTTGAGGG + Intronic
989086721 5:37684728-37684750 TGTCAGCAAAAGCATTTTGTAGG + Intronic
990037739 5:51342615-51342637 TGGGAGCCAGAGCATCTTGTGGG - Intergenic
993834799 5:92805639-92805661 TTTTAGGAAGAGTATCTTGTAGG + Intergenic
997740647 5:136250428-136250450 TGGTAGCTACAACATCTTGAAGG - Intronic
999918902 5:156296029-156296051 TGTGAGCCAGAGCATCTGTTGGG + Intronic
1000833930 5:166133191-166133213 TGTGAGTTTGAGCATCTTCTAGG + Intergenic
1001234833 5:170020816-170020838 TCTTCCCTGGAGCATCTTGTTGG - Intronic
1002820541 6:720464-720486 CGCTAGATATAGCATCTTGTTGG + Intergenic
1003940808 6:11023963-11023985 TGTTAGTTTAAGCATCTTCTAGG + Intronic
1012810574 6:103951871-103951893 TATTAGTTAAAGCTTCTTGTTGG - Intergenic
1019880423 7:3855137-3855159 TCTTATCTAGATCATCTTCTGGG - Intronic
1028208307 7:88042299-88042321 TGTTAGCTAGAGCATCTTGTAGG + Intronic
1028356582 7:89917651-89917673 TGTTCTCTATAGTATCTTGTAGG + Intergenic
1028639925 7:93030261-93030283 TGTCAGCTAAAGCACTTTGTAGG - Intergenic
1028682180 7:93548239-93548261 TCTTGGATAGAGCATCTTTTGGG + Intronic
1029538719 7:101170761-101170783 TGTTAGCTTGAACTTCTTGTTGG - Exonic
1032079713 7:128852791-128852813 TGTTAGGCAGAGCATCCTGTGGG - Intronic
1042301210 8:67284589-67284611 TGTTAGTAATGGCATCTTGTTGG + Intronic
1045965705 8:108022050-108022072 TGTTAGCTAGAAGATGTGGTGGG - Intronic
1048008348 8:130437293-130437315 TGTGAGCTGGGGCATCTTGAAGG - Intronic
1051486435 9:17613733-17613755 TGCAGGCTAGAGCATCTTGCTGG - Intronic
1057060257 9:91997769-91997791 TGTTAGGTAGATTATTTTGTTGG + Intergenic
1058429552 9:104906115-104906137 TCTCAGCTAGAGGATATTGTTGG - Intronic
1186653087 X:11582273-11582295 AGTTAGCAAAAGTATCTTGTAGG - Intronic
1188164429 X:26844574-26844596 AGGTAGCAAGATCATCTTGTAGG + Intergenic
1189094908 X:38127851-38127873 GGATAGCCAGAGCATCTTGATGG + Exonic
1190452340 X:50594578-50594600 TGTGGGCTAGAGCACCTTTTTGG - Exonic
1192661032 X:73043169-73043191 TGTTGGCTATAGCATCCTATAGG - Intergenic
1194085678 X:89524900-89524922 TGCTGGCTAAAGCATTTTGTTGG + Intergenic
1196047017 X:111267208-111267230 TGTTAGCTAGAGGCTCTCCTTGG - Intronic
1197578952 X:128257621-128257643 TGTTGGCTAGAGTATTTTGTAGG - Intergenic
1198193542 X:134336135-134336157 TGTTATCTAGAGCATTGTCTTGG + Intergenic
1199311064 X:146319970-146319992 TATTAGCTTAAGCATCTTTTGGG - Intergenic
1200438324 Y:3180783-3180805 TGCTGGCTAAAGCATTTTGTTGG + Intergenic
1201265955 Y:12206787-12206809 TGTTTCCTAGAGCATCTAGAAGG + Intergenic