ID: 1028209494

View in Genome Browser
Species Human (GRCh38)
Location 7:88055759-88055781
Sequence AGCGTTATGAAAGGTGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028209494 Original CRISPR AGCGTTATGAAAGGTGTGTT AGG (reversed) Intronic
900708122 1:4093416-4093438 ACAGTTATGACAGGTGTGTTGGG + Intergenic
902148327 1:14421787-14421809 AGGGTTTTGAAAGGTGAGCTTGG - Intergenic
907917245 1:58882371-58882393 ACGGTTATGGAAGGTGTGGTGGG + Intergenic
912777454 1:112514738-112514760 AGCTTTATGGAATGTGGGTTAGG + Intronic
915411756 1:155706473-155706495 TGGGTTGTGAAAGGTGTGTCTGG + Intronic
923078653 1:230633015-230633037 AGAGATAGGGAAGGTGTGTTAGG + Intergenic
923647101 1:235834863-235834885 ACAGGTATGGAAGGTGTGTTAGG - Intronic
1075762389 10:124866520-124866542 TGCGTTCTGAAAGGTGTGCAGGG + Intergenic
1077605092 11:3604350-3604372 AGGGTGATGAAAGGTCTGTCTGG - Intergenic
1077994322 11:7440161-7440183 ACAGTGATGAATGGTGTGTTTGG + Intronic
1082033234 11:47622334-47622356 GTGGTTATGAAAGGTGAGTTTGG + Intronic
1084384890 11:68837375-68837397 AGCGTTAGGAAAGCTGTCTGTGG + Intronic
1088111890 11:106271390-106271412 AGCTTGATGAAATGTGGGTTTGG + Intergenic
1091087088 11:132731906-132731928 AGAGGTATGAAAGGTGAGGTTGG + Intronic
1108144277 13:47460540-47460562 AGCCATATGAAATGTGTATTAGG - Intergenic
1108289560 13:48945278-48945300 AGAGTAATGACATGTGTGTTTGG + Intergenic
1109005284 13:56867522-56867544 AGTCATATGAAAGGTGTGATTGG - Intergenic
1114182776 14:20379835-20379857 AGAGTGATAACAGGTGTGTTTGG + Intronic
1117959977 14:61153230-61153252 AGAGTAATGAAAGGTTTGGTAGG + Intergenic
1124327487 15:28780222-28780244 GGTGTTATTAAAGGTCTGTTGGG + Intergenic
1125166355 15:36710451-36710473 AGCGTTAAGAAAGGAGTGGGAGG + Intronic
1126381526 15:48052650-48052672 AACCTAATGAAAGGTATGTTAGG + Intergenic
1135544703 16:23357852-23357874 AGCCTTATGGCAGGTGTGGTTGG - Intronic
1139407585 16:66731260-66731282 AGCCCTGTGAGAGGTGTGTTTGG - Intronic
1145997287 17:29111934-29111956 AGCATTCTGTAGGGTGTGTTTGG - Intronic
1147408982 17:40235537-40235559 GGCTTTATGAAAGGAGTCTTTGG + Intronic
1149036531 17:52140670-52140692 AGCGTTATGAAATCTGCTTTAGG + Intronic
1149384751 17:56131219-56131241 AGCATTATGGATGGTGTATTGGG - Intronic
1156108493 18:33694238-33694260 AGCGTTCTGCAAGATGTGCTTGG + Intronic
1159087408 18:63809496-63809518 AGCGCAGTGAAAGGTGGGTTGGG + Intergenic
1159158802 18:64618059-64618081 AACGGTATGAATGGTGTGGTTGG + Intergenic
1162264015 19:9555235-9555257 AACGTGATGAAAAGTGTGCTTGG + Intergenic
1165585772 19:36914955-36914977 AGCAGTATCCAAGGTGTGTTGGG - Exonic
1168212775 19:54902776-54902798 AGAGTTATGACAGCTGTGTAAGG + Intergenic
927066971 2:19481347-19481369 AGGGTTCAGAAAGGGGTGTTTGG + Intergenic
927078943 2:19608976-19608998 ATTGTTATGAGAGGTGTATTGGG - Intergenic
929295930 2:40246636-40246658 TTCCTTATGAAAGGTCTGTTTGG - Intronic
936063593 2:109313892-109313914 AGATATTTGAAAGGTGTGTTGGG + Intronic
937595968 2:123673856-123673878 AGCCTTTTGAGATGTGTGTTAGG - Intergenic
939718314 2:145614212-145614234 AGGAGTATGGAAGGTGTGTTGGG + Intergenic
946880866 2:224176021-224176043 AGAGTTAAGAAGGGTGTGTTTGG + Intergenic
1169431807 20:5542961-5542983 AGCTTTATGTTATGTGTGTTAGG - Intergenic
1170190180 20:13638255-13638277 AGGGGAAGGAAAGGTGTGTTAGG - Intronic
1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG + Intergenic
1181221690 22:21367906-21367928 AGAGTTGTGAAGGGTGGGTTTGG - Intergenic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
952374670 3:32756135-32756157 AGAGTGATGAGAGGTGAGTTGGG + Intronic
952779996 3:37087148-37087170 AGCATTATTAAAAGTGTGTGTGG - Intronic
953773742 3:45798319-45798341 GGCCTTAGGATAGGTGTGTTTGG + Intergenic
955870632 3:63434704-63434726 GGCTTTAAGAAATGTGTGTTAGG + Intronic
956581198 3:70816012-70816034 AGCATTATAAAAGGTGGGTGGGG - Intergenic
959356371 3:105334601-105334623 AGCCCTGTGAAAGCTGTGTTTGG - Intergenic
965700238 3:171453267-171453289 AGTGTTATGAAAGAGGTGTGAGG + Intronic
974837053 4:67263858-67263880 AGAGTCAGGAAAGGTGTTTTAGG + Intergenic
978133371 4:105226858-105226880 AACCTTTTGAAAGGTATGTTAGG - Intronic
978573350 4:110164419-110164441 AGACTTATGAAAGCTGAGTTAGG - Intronic
981028436 4:140099757-140099779 AAGGTTTTGAGAGGTGTGTTGGG - Intronic
981828195 4:148969192-148969214 AGCTTAGTGATAGGTGTGTTAGG + Intergenic
982269356 4:153570657-153570679 AGTGGTATGGAAGCTGTGTTAGG + Intronic
984633004 4:182080155-182080177 AGAGTTTTGAAACGTGGGTTAGG - Intergenic
987466730 5:18280683-18280705 AGCATGATGGAAGGTGTGATGGG + Intergenic
993508246 5:88737906-88737928 AGCTTTATTAAATTTGTGTTAGG + Intronic
995657544 5:114443887-114443909 AGTGTCAGGAAAGGTGGGTTGGG + Intronic
998830436 5:146152241-146152263 AGTGTTGGGAAAGGTGTGTGTGG - Intronic
999478455 5:151923788-151923810 AGAGTTTGGAAAGGTGGGTTGGG + Intronic
1004388737 6:15191535-15191557 AGCCCTAGGAAAGGTGTCTTTGG - Intergenic
1005968007 6:30741347-30741369 AGGGGTAGGAAAGGTGTGGTGGG + Intronic
1005978840 6:30820475-30820497 AGAGTTATGAGAGGTGTGGTTGG + Intergenic
1009707431 6:67270725-67270747 AGAGTTTTGACAGGTGTGATTGG - Intergenic
1016158556 6:140845780-140845802 AGAGCTATGTGAGGTGTGTTAGG + Intergenic
1018280971 6:162185053-162185075 ATCGTTATGAAACTTGTATTGGG + Intronic
1018329062 6:162708511-162708533 AGTGTCATGAAAGCCGTGTTAGG - Intronic
1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG + Intergenic
1024959244 7:54957630-54957652 AGCATTTTGAAAAGTGTTTTGGG - Intergenic
1025509760 7:61494640-61494662 AGCGTTTTGAAGGCTGTGGTTGG + Intergenic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1032450651 7:132027622-132027644 TGGGTTATTAAAGGTGGGTTGGG + Intergenic
1032483522 7:132265493-132265515 AGCAATATGAAGGGTGTGTATGG + Intronic
1034587690 7:152110080-152110102 AACATTATGAAATGTCTGTTGGG + Intronic
1038963888 8:32549920-32549942 TGCTTCATGAAATGTGTGTTGGG - Intronic
1039004711 8:33021538-33021560 AGAGTTTTGAAAGGTGGGTGTGG + Intergenic
1041958677 8:63586072-63586094 AGAGGTATGAAAGGTGAGTCAGG + Intergenic
1042309123 8:67362749-67362771 GGAGTTATGAATGGTATGTTAGG - Intergenic
1044375529 8:91465692-91465714 TGCTTTATGAAAGGTGGGTGGGG - Intergenic
1051411376 9:16793368-16793390 ACCTTGATGAAAGGTGTGATGGG - Intronic
1059785689 9:117580755-117580777 AGCTTTTTTAAAGGTGTGTGTGG + Intergenic
1197310017 X:124893433-124893455 AAAGATATGAAAAGTGTGTTTGG + Intronic
1197899892 X:131359192-131359214 AGAGTTATGGAAGGAGTGTTAGG - Intronic