ID: 1028215384

View in Genome Browser
Species Human (GRCh38)
Location 7:88125906-88125928
Sequence GAACCCAAGGTGCCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028215384_1028215390 25 Left 1028215384 7:88125906-88125928 CCTGCTTGTGGCACCTTGGGTTC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1028215390 7:88125954-88125976 CCCAGATATGTACCACATCGTGG No data
1028215384_1028215386 -10 Left 1028215384 7:88125906-88125928 CCTGCTTGTGGCACCTTGGGTTC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1028215386 7:88125919-88125941 CCTTGGGTTCTTTCTACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028215384 Original CRISPR GAACCCAAGGTGCCACAAGC AGG (reversed) Intronic
900915260 1:5633004-5633026 GAAGCCAAGGTGACACAGGATGG - Intergenic
901453339 1:9349364-9349386 GGCCCCATCGTGCCACAAGCAGG - Intronic
903056505 1:20639853-20639875 GAACCCAGGGTTACACAGGCCGG - Intronic
904537303 1:31208347-31208369 GAACACAAGTTTCCATAAGCGGG - Intronic
905003701 1:34693808-34693830 GAGCCCAAGGAGCCAGAAGTTGG + Intergenic
909350807 1:74651319-74651341 GAAACCAAGGTGCCACATGAGGG + Intronic
910138559 1:83999992-84000014 GAACCCAGCGTGACAGAAGCAGG - Intergenic
911651751 1:100396800-100396822 AAACCAAAAGTGCCACAAGATGG - Intronic
917382890 1:174434153-174434175 GAACCCTAGTTGCCCCAGGCAGG - Intronic
920297009 1:204964405-204964427 GAAGCCAAGGGGCAAAAAGCAGG + Intronic
922119119 1:222644611-222644633 GGACCCAAGCTGTCACAGGCGGG + Intronic
922897892 1:229114676-229114698 GCACCCGAGGGGCCACAGGCAGG + Intergenic
1067526593 10:47043033-47043055 CCACCCAGGGTGCCACACGCAGG + Intergenic
1069687321 10:70326557-70326579 GAACCCAAGGTTCCATCAACAGG + Intronic
1073206477 10:101772066-101772088 GAACCCAAAGTGGCAGAAACAGG - Intronic
1080206810 11:29738818-29738840 GAACTAAAGTTGCTACAAGCTGG - Intergenic
1083899083 11:65635075-65635097 GAACCCCAGGCGCCACAACGCGG - Exonic
1089138281 11:116266713-116266735 GAACCCAAGGTTCCACAGCTGGG - Intergenic
1090226379 11:125074553-125074575 GAACACCTGGGGCCACAAGCAGG + Intronic
1092671664 12:10868475-10868497 GAATCCAAGGTGTCACATGCAGG - Intronic
1096559924 12:52428814-52428836 CCACCCTGGGTGCCACAAGCAGG + Intronic
1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG + Intronic
1096799066 12:54097346-54097368 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1099747933 12:86731615-86731637 GGAAACAAAGTGCCACAAGCTGG - Intronic
1106554295 13:30796918-30796940 GGAGCCATGGAGCCACAAGCTGG - Intergenic
1111658962 13:91185673-91185695 GAAACTAAGGTGCCTAAAGCTGG - Intergenic
1111781352 13:92729813-92729835 GAAAACAAGGTGCCACACACTGG - Intronic
1113728405 13:112622724-112622746 TGAGCCAAGGAGCCACAAGCTGG + Intergenic
1122877673 14:104676449-104676471 AAACACAAGGTTCAACAAGCGGG - Intergenic
1126795244 15:52255206-52255228 GAACCCAAGGTCCCAGAGGGAGG + Intronic
1128053420 15:64682648-64682670 GACTCCAAGGTTCCCCAAGCTGG - Exonic
1129759670 15:78122134-78122156 GAACCCAAGGAGCCCCTAACAGG + Intronic
1138016783 16:53435188-53435210 GAGACCCAGGTGCCACAACCCGG - Intronic
1143628463 17:8123902-8123924 GAACTCCAGGAGCCAGAAGCTGG - Intronic
1147325319 17:39667169-39667191 GAACCCACGGTGGCAGGAGCTGG + Intergenic
1148094870 17:45045394-45045416 GTATCCAAGGTGCCAAAAACAGG + Intronic
1151817971 17:76480876-76480898 AAGCCCACGCTGCCACAAGCCGG + Intronic
1151951144 17:77354797-77354819 GGACGCAAAGTGCAACAAGCAGG - Intronic
1152083415 17:78202828-78202850 GCAACCAAACTGCCACAAGCTGG + Intronic
1152375923 17:79919028-79919050 GAAGCCAGGGAGCCACATGCTGG - Intergenic
1152735062 17:81993133-81993155 AAGCCCAAGGTGCCACACCCAGG - Intronic
1160038374 18:75321785-75321807 GAACCCAAGCTGCAACACTCTGG + Intergenic
1166165830 19:40987674-40987696 GAAGCCAAAGAGCCACAAGGCGG - Intergenic
1166541201 19:43607336-43607358 GACCCCAAGGTTCCCCAAGAAGG + Exonic
1168339650 19:55615748-55615770 GAACCTCATGTGGCACAAGCTGG + Exonic
928403631 2:30997274-30997296 GAGCCCAAAGTGCCACAGGAGGG + Intronic
932490181 2:72115368-72115390 GAAGCCCAGGTGCCAGAGGCTGG + Intergenic
932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG + Intronic
934045608 2:88170575-88170597 GAACCAAAGGTTCCAGAAACGGG - Intronic
938262112 2:129903665-129903687 AAAGCCCAGGTGCCACAAGCTGG + Intergenic
945403658 2:209420693-209420715 GTACCCAAGGTCACACAAGCAGG + Intergenic
946941959 2:224778599-224778621 TACCCCAAGCTGCCACAAGAGGG - Intronic
948627316 2:239277040-239277062 GAGTCCCAGGTGCCACCAGCAGG - Intronic
1170896876 20:20422959-20422981 GATTCCAAGTTGCCACAGGCTGG - Intronic
1171797355 20:29577003-29577025 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1171850896 20:30307158-30307180 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1172623145 20:36332634-36332656 GCACCCAAGATGGCACAGGCGGG - Intronic
1175165537 20:57041303-57041325 GTCCCCAAGGGGCCAGAAGCGGG - Intergenic
1175826691 20:61940135-61940157 GGACCCACGGCGCCACGAGCTGG - Exonic
1184908084 22:47505363-47505385 GAACCCAAGGGTCCTCTAGCAGG + Intergenic
1185402768 22:50627241-50627263 CACCCCAAGGTGCCACTTGCCGG + Exonic
949691159 3:6641134-6641156 GAACTCAAGTTGTCACAAGCAGG + Intergenic
951303746 3:21030814-21030836 GAACCTGAGGTGCCATAAGTGGG - Intergenic
954107791 3:48418655-48418677 GACCCCATGGGGCCACAAGTTGG + Intronic
955414921 3:58683312-58683334 GAACCACAAGTGCCACAAGAAGG + Intergenic
955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG + Intergenic
957450585 3:80377074-80377096 GAACCCAGGATGCCAGAAGGCGG - Intergenic
960395322 3:117130591-117130613 GAACCCAAGCTGCCAGACTCTGG - Intronic
961659234 3:128459582-128459604 GAACCCAGGGAGCCACAACCTGG + Intergenic
961809778 3:129515085-129515107 GAACCCAAGGTGCAGAAAGATGG - Intronic
963080006 3:141382739-141382761 GAACCTAGGATGCCACCAGCTGG - Intronic
965616894 3:170603167-170603189 AAGCCAAAGGGGCCACAAGCAGG - Intronic
966581430 3:181570133-181570155 GAAGCCAAGGTGTCATCAGCAGG + Intergenic
970629412 4:17924425-17924447 GAGCCCAATTTGCCAGAAGCCGG + Intronic
970644954 4:18109047-18109069 GAGCCCAATTTGCCAGAAGCAGG - Intergenic
977427900 4:96892197-96892219 CAAACCAAGGTGCAACAAGTGGG + Intergenic
981220679 4:142229995-142230017 GAAACCAAGGTACCACTAACTGG + Intronic
982225557 4:153162827-153162849 GAACCCAAGATGCCACCTGAGGG + Intronic
983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG + Intergenic
986723580 5:10577857-10577879 GACCCCACGGTGCAGCAAGCTGG - Intronic
991481017 5:67079842-67079864 GAACACAAAGTTCCACATGCTGG + Intronic
994086891 5:95768865-95768887 GCACACAAGGTGCCACCAGGTGG + Intronic
999811481 5:155131509-155131531 GAACCCCAGGCTCCAGAAGCAGG - Intergenic
1001903044 5:175446532-175446554 TAAGCCAAGGTGCCAAAGGCCGG - Intergenic
1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG + Intergenic
1018768440 6:166952279-166952301 GTAACAAAAGTGCCACAAGCTGG - Intronic
1020153963 7:5706396-5706418 GAACCCTGGGTGCCAGAGGCTGG - Intronic
1021219765 7:17962519-17962541 GAGCCCAAAGTGCTACAGGCGGG + Intergenic
1023600260 7:41875455-41875477 GATCCCAAGGAGTCACAAACAGG - Intergenic
1023724306 7:43126147-43126169 GAATCCAAGGAGACTCAAGCTGG - Intronic
1027400213 7:77798871-77798893 GAGCCCAAGGAGCCACAACGAGG - Exonic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029252395 7:99246277-99246299 CAAACCCAGCTGCCACAAGCAGG + Intergenic
1031455386 7:121972886-121972908 CAACCCAAAGTGCCACAAAATGG + Intronic
1032696320 7:134339696-134339718 CAGCCCAAGGTTACACAAGCAGG + Intergenic
1033684999 7:143630871-143630893 TAACCCAAGCTGCAACAAGGGGG - Intronic
1033688172 7:143710090-143710112 TAACCCAAGCTGCAACAAGGGGG - Intronic
1033699614 7:143826750-143826772 TAACCCAAGCTGCAACAAGGGGG + Intergenic
1038113820 8:24530181-24530203 AAAGCCAAGGTGCTACAAGGTGG + Intergenic
1046152387 8:110244651-110244673 GAAAGCAAGGTGCCAGAAGTGGG - Intergenic
1048319800 8:133389589-133389611 CGACCCAAGGTCCCACAGGCAGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG + Exonic
1053023115 9:34709313-34709335 GAACCCAAGATGCAAGAAGGAGG - Exonic
1053788676 9:41670450-41670472 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1054156462 9:61644318-61644340 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1054176961 9:61881789-61881811 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1054476233 9:65575327-65575349 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1054660573 9:67699017-67699039 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG + Intergenic
1060983497 9:127807079-127807101 GAGACCAAGGTGCCGCATGCAGG + Exonic
1061284487 9:129614254-129614276 GAAACCAAGGCCCCAGAAGCAGG - Intronic
1061401496 9:130370773-130370795 GAGCCCATGGCGCCACAGGCTGG - Intronic
1062430532 9:136525139-136525161 GAAACCAAGGTGCCAGGAGGAGG + Intronic
1186456959 X:9717343-9717365 GAACCGAAGAAGCCACAGGCAGG + Exonic
1187048879 X:15676120-15676142 GAAACCAAGGAGCAGCAAGCTGG + Intergenic