ID: 1028215385

View in Genome Browser
Species Human (GRCh38)
Location 7:88125919-88125941
Sequence CCTATGGTAGAAAGAACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028215385_1028215390 12 Left 1028215385 7:88125919-88125941 CCTTGGGTTCTTTCTACCATAGG 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1028215390 7:88125954-88125976 CCCAGATATGTACCACATCGTGG No data
1028215385_1028215393 27 Left 1028215385 7:88125919-88125941 CCTTGGGTTCTTTCTACCATAGG 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1028215393 7:88125969-88125991 CATCGTGGAATCCACTTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028215385 Original CRISPR CCTATGGTAGAAAGAACCCA AGG (reversed) Intronic
905423754 1:37866718-37866740 CCTATTGTAGAAACATGCCAGGG - Intronic
906580556 1:46932063-46932085 ACTATGGTATAAAGATCTCAAGG + Intronic
906603169 1:47146829-47146851 ACTATGGTATAAAGATCTCAAGG - Intronic
909878359 1:80840021-80840043 CCTATGGTAGAAGCAAGCAAGGG + Intergenic
911272334 1:95817641-95817663 CCTGTGGGAGAAAAAACACAGGG + Intergenic
912805896 1:112756917-112756939 TCTATGGTCCAAGGAACCCAAGG + Intergenic
912870335 1:113298569-113298591 AGTATGGTAGAAAGAACACTAGG - Intergenic
920422097 1:205841911-205841933 CAGATGTTAGAAAGAACCAATGG + Intronic
924363268 1:243263269-243263291 CCTCTGGTAGGCAGAAGCCAGGG + Intronic
924369194 1:243329542-243329564 GAAATGGTAGAAAGAACCCCAGG - Intronic
1063475380 10:6323976-6323998 CAAAAGGTAGAAACAACCCAAGG + Intergenic
1066309833 10:34185666-34185688 ACTTTGGTAGAAAGAAGCCAGGG + Intronic
1068715353 10:60181533-60181555 TCTATGTTAGAAAAAACCTATGG + Intronic
1069875747 10:71561935-71561957 TCTTTGGAAGAAAGACCCCATGG - Intronic
1070029300 10:72661694-72661716 CCTATTCTTGAAAGAAACCAAGG + Intergenic
1071228081 10:83554744-83554766 CCTAAGGTAAATAGAAACCATGG - Intergenic
1072494488 10:95942579-95942601 CCTATACTAGAAAGAACACAAGG - Intergenic
1072891893 10:99331060-99331082 CCTATGGTACTAAAAACCCAAGG + Intronic
1073061879 10:100738155-100738177 CCCAAGGTAGAAAGAAACCTGGG - Intronic
1073632509 10:105162665-105162687 CTTATGGTGGTAAGAACCCAAGG - Intronic
1075795247 10:125115540-125115562 CCTTTGAAAGAGAGAACCCATGG + Intronic
1078064671 11:8070572-8070594 ACTATGTTAGAAAGGACTCATGG - Intronic
1085924940 11:81006270-81006292 CACATGGTAGAAAGAACACTGGG + Intergenic
1086174779 11:83878057-83878079 ACTGTTGTAGAAAGAACCAAGGG + Intronic
1086859841 11:91912770-91912792 CATATTGTAGAAAGTACACAGGG - Intergenic
1088589767 11:111393405-111393427 ACTATGGTGCACAGAACCCACGG + Intronic
1088971089 11:114775282-114775304 CCTCTGCTAGACAGACCCCAGGG + Intergenic
1089872455 11:121688018-121688040 CCTATGGGAGCAAGTACACAGGG - Intergenic
1089933993 11:122344464-122344486 ACTATGCTGGAAAAAACCCAAGG + Intergenic
1090599391 11:128354770-128354792 TCTCTGGTAGAAAGAACCAATGG - Intergenic
1090731946 11:129580010-129580032 GCTGTGGTAGAACGAAGCCAAGG - Intergenic
1091614018 12:2035368-2035390 CCTCTTGCAGACAGAACCCAGGG - Intronic
1091697961 12:2640721-2640743 CCTATGGTGGAAAGATACTAAGG - Intronic
1092559160 12:9591730-9591752 ATTATGGTAGAAAGATCTCAAGG - Intergenic
1095201091 12:39385145-39385167 ACTATGGCAGACAGACCCCAAGG - Intronic
1095207395 12:39454273-39454295 TGTATGGTAGAAAGAACACTTGG + Intergenic
1097014382 12:55974636-55974658 CCTATTGTAAAAAGAACTGAGGG + Intronic
1098146883 12:67506508-67506530 CCTTTTGTAGACAGAAACCAAGG + Intergenic
1098915988 12:76257320-76257342 CCTAAGTTACAAAGAAACCATGG + Intergenic
1102772952 12:115494481-115494503 CCAAAGGTAGCAAGAAGCCATGG + Intergenic
1103023669 12:117556632-117556654 CCTAATTTAGAATGAACCCAAGG - Intronic
1108568728 13:51728745-51728767 CCTTTGGGAGGAAGAACACATGG + Intronic
1108724471 13:53164741-53164763 CATGTTGTAGGAAGAACCCAAGG - Intergenic
1119350189 14:73958224-73958246 CCTAGGGTAATATGAACCCAAGG - Exonic
1122169458 14:99860012-99860034 CTTATTTTAGAAAGAATCCAAGG + Intronic
1125390036 15:39182302-39182324 GCTATGGAAGAAAGAAACAAAGG + Intergenic
1125693956 15:41619987-41620009 GCTATAGTGGAAAGAACCCAAGG - Intergenic
1126353155 15:47766155-47766177 CCTGTGGTAGAGTGACCCCAGGG + Exonic
1129031401 15:72620568-72620590 ACTATAGTAGGAAGAGCCCAGGG + Intergenic
1129167093 15:73784778-73784800 ACTGTGGTAGAGAGAATCCAAGG - Intergenic
1129218537 15:74116869-74116891 ACTATAGTAGGAAGAGCCCAGGG - Intronic
1135244406 16:20842753-20842775 TCAAAGGTAGAAACAACCCAGGG - Intronic
1138490944 16:57376344-57376366 CCTATGGGAGAAAGAGCTCAAGG + Intronic
1144435168 17:15233531-15233553 CCTCTGGAAGGAAGCACCCAAGG + Intronic
1145816410 17:27798148-27798170 CCTGTGGTATGAGGAACCCAAGG - Intronic
1148051932 17:44773788-44773810 CTTATGGGCAAAAGAACCCAAGG + Intronic
1155628074 18:27859682-27859704 TCTATGGTAGAAAGAAAACGAGG - Intergenic
1156798437 18:41077582-41077604 CCTATGATTGAAAGCAACCACGG + Intergenic
1157021827 18:43792473-43792495 CCTATGGTAGAAAGAATCAGAGG - Intergenic
1157081968 18:44535173-44535195 CAGATTGTAGAAGGAACCCATGG + Intergenic
1157470663 18:47985540-47985562 CCTTTTGGGGAAAGAACCCAGGG + Intergenic
1160016497 18:75145179-75145201 CATATTGTAGGAGGAACCCAGGG - Intergenic
1161239943 19:3217006-3217028 CCAAAGGTGGAAACAACCCAAGG + Intergenic
1161289567 19:3485843-3485865 CCCATTGTAGAGAGAAGCCAGGG - Intergenic
1162544951 19:11323640-11323662 CCTCTGGTATGAAGAAACCAGGG + Exonic
1167301351 19:48679847-48679869 CCTCAGGTGGAAAGACCCCAGGG + Intergenic
1168038345 19:53738179-53738201 CTTCTGGTAGAGAGAACCCCTGG + Intergenic
927143195 2:20143523-20143545 CCTAGGGTAGAGGGAGCCCAGGG - Intergenic
930523437 2:52497142-52497164 CCTTTTGTAGCAAGAACCTATGG + Intergenic
932439183 2:71721072-71721094 CATGTGTTAGAAAGAAGCCAGGG - Intergenic
936573738 2:113636634-113636656 CATATGGTTAAAAGAACACATGG + Intronic
936684499 2:114811802-114811824 TCTATTGTAGAGAGAACACACGG - Intronic
936906955 2:117547867-117547889 CACATGGTAGAAAGAAAACATGG - Intergenic
941678484 2:168370011-168370033 ACTATTGTAGAAAAAAGCCATGG + Intergenic
945801288 2:214434559-214434581 CCTATGGTAGTAAGAGGCAAAGG - Intronic
946956094 2:224931389-224931411 CCTATAATAGAAAGTACCCCAGG - Intronic
947345011 2:229181268-229181290 CCGAAGGGAGAAAGAGCCCAGGG + Intronic
949053091 2:241908108-241908130 CCTAAGGGAGAAAGGACTCAGGG - Intergenic
1170434682 20:16314392-16314414 GCTTTGGTAGAAAGAACACTAGG - Intronic
1172314761 20:33945013-33945035 GCATTGGTAGAAAGAGCCCATGG - Intergenic
1173124599 20:40325141-40325163 CCTATGGAGGGAAGAACCCATGG + Intergenic
1174028599 20:47601249-47601271 CCTGTGGGAGCAAGAACTCAAGG + Intronic
1174556264 20:51397697-51397719 CCTATGGCAGAAGGAAGCCCTGG - Intronic
1177295724 21:19172597-19172619 CCTATGACAGTAATAACCCAAGG - Intergenic
1177297619 21:19197447-19197469 CCTAAGTTAGACACAACCCAAGG + Intergenic
1177335228 21:19716108-19716130 CCTATGGGAGAAAGAAAACATGG + Intergenic
1178089319 21:29144547-29144569 GGTATGGTGGAAAGAGCCCAGGG + Intronic
1178470654 21:32889603-32889625 CCAAAGGTGGAAACAACCCAAGG + Intergenic
1179471050 21:41610709-41610731 TCAATGGTAGAAGGAACACAAGG + Intergenic
1182153193 22:28045388-28045410 CCTGTAGTAGAAAGAGCCCAAGG + Intronic
1184330716 22:43825570-43825592 CGAATGGTAGAAAGATCTCAGGG - Exonic
1185426439 22:50774245-50774267 CATATGGTTAAAAGAACACATGG - Intronic
949101653 3:152814-152836 CCCCTTGTAGAAAGAAGCCAAGG + Intergenic
949167445 3:959355-959377 CCTATGGTAGACACAAACCCTGG + Intergenic
949406056 3:3716142-3716164 CCCATGGTAGAAAGAGCAAAGGG + Intronic
951294302 3:20915197-20915219 CCTTGGGTATAAAGTACCCAAGG - Intergenic
958456205 3:94334867-94334889 ACTCTGGTAGAAAGAAGGCATGG + Intergenic
958906284 3:99945432-99945454 CCTTTGTTAGAAAGCACCCAGGG + Intronic
971848446 4:31950029-31950051 CCAATGGGAGAAAGAAGTCAAGG - Intergenic
971897980 4:32621516-32621538 CCTTTGGTAGAAAGAACTTCTGG - Intergenic
973294024 4:48495837-48495859 CCTGTGGTAGAAAACAACCAGGG + Intergenic
973339793 4:48992515-48992537 CCTCTGGGAAAAAAAACCCAGGG - Intronic
975834370 4:78406581-78406603 CATATTGTAGAAGGGACCCAGGG - Intronic
979488843 4:121300853-121300875 CCTCTAGTTGAAAGAATCCAGGG + Intergenic
979782932 4:124678733-124678755 GCCATGGTGGAAAGAACTCATGG + Exonic
984440498 4:179763401-179763423 CCTGTGGTAGAAAAAACCTCTGG - Intergenic
984595248 4:181659378-181659400 CCTGTGCAAGAAAGAACTCAGGG - Intergenic
989133341 5:38128962-38128984 CTTATGCTAGAGAGAGCCCAAGG - Intergenic
990286055 5:54301776-54301798 CCTGTTGAAAAAAGAACCCAAGG + Intronic
990432324 5:55747965-55747987 CCTATGGTGGAAAACACCCATGG + Intronic
990983184 5:61619731-61619753 CCCTTTGTAGAAAGTACCCAGGG - Intergenic
992792952 5:80230068-80230090 CCCAGGGCAGAAGGAACCCAAGG + Intronic
995026428 5:107428982-107429004 ACTATACTAGAAAGAACCAAGGG - Intronic
996506250 5:124270781-124270803 CCAATGGGAAAAACAACCCAGGG - Intergenic
997416931 5:133736153-133736175 CCTACGGTAAAAGGAAGCCAAGG + Intergenic
1002807394 6:590441-590463 ACTATGCTAGAAAGAAACAACGG + Intronic
1004534111 6:16483017-16483039 CCCATGGTAGAGAGGACCCAAGG + Intronic
1005028598 6:21488330-21488352 CCATTGGTGGAAAGTACCCAGGG + Intergenic
1009706282 6:67256412-67256434 CCTTTGGAAGAAAGAAGTCATGG - Intergenic
1010405686 6:75503523-75503545 CTTATGGTAGAAACAGCCCTGGG + Intergenic
1010878747 6:81141638-81141660 CCTATGCCAGAAAAAGCCCATGG + Intergenic
1013923396 6:115438267-115438289 ACAAAGGTAGAAACAACCCAAGG + Intergenic
1015273663 6:131362738-131362760 CATATGGTAGAAAAAGCCCTGGG - Intergenic
1018344860 6:162890189-162890211 AGAAAGGTAGAAAGAACCCATGG - Intronic
1023199640 7:37682354-37682376 CTTAAAATAGAAAGAACCCAGGG + Intergenic
1023433538 7:40118770-40118792 GCAATGGTAGAAAGAAAACATGG - Intergenic
1023713102 7:43015456-43015478 CCTTTGTTAGAAAGATACCATGG - Intergenic
1028215385 7:88125919-88125941 CCTATGGTAGAAAGAACCCAAGG - Intronic
1030929527 7:115504765-115504787 CCTATGGTAGAAAAAATTTAAGG - Intergenic
1031342681 7:120623498-120623520 CTTATGGTAGCAAGATCCCTAGG - Intronic
1035242815 7:157543309-157543331 CCTGTTGGAGAAAGATCCCACGG + Intronic
1035412363 7:158655455-158655477 CCTGTAATAGAAAAAACCCAAGG + Exonic
1035768128 8:2125028-2125050 CAAAAGGAAGAAAGAACCCATGG - Intronic
1036799126 8:11776753-11776775 CCCAAGGAAGAGAGAACCCAGGG - Intronic
1039397597 8:37240478-37240500 CCTCTGGTAGACAGCAGCCAAGG + Intergenic
1044818524 8:96138343-96138365 AGAATGGTATAAAGAACCCATGG + Intergenic
1047181524 8:122593406-122593428 CCTCTGTTGGAAAGACCCCAGGG + Intergenic
1048190669 8:132285725-132285747 ACTATGGGAGAAAGATGCCAAGG + Intronic
1048273335 8:133046637-133046659 CCAAAGGGAGGAAGAACCCAGGG - Intronic
1048398219 8:134035661-134035683 CCTATGTCAGCAGGAACCCAGGG + Intergenic
1048917566 8:139199411-139199433 CGTATTGTAGGAGGAACCCAGGG + Intergenic
1050626342 9:7507861-7507883 CCTACTGCATAAAGAACCCATGG - Intergenic
1050981698 9:12025962-12025984 CCTATGTTAGAAAGGAGCTAAGG - Intergenic
1055728900 9:79260701-79260723 CTTATGCTGGAAATAACCCAAGG - Intergenic
1055843153 9:80530709-80530731 CGTATTGTGGAAGGAACCCAGGG - Intergenic
1058230957 9:102424197-102424219 CCTATGGTAGTCAGCATCCAAGG + Intergenic
1059335049 9:113563863-113563885 CCTATGGTAGAGACCCCCCAGGG - Intronic
1060508916 9:124218138-124218160 CCTAGGGTACCAAGAAACCAGGG - Intergenic
1060766059 9:126295808-126295830 CCAAAGGTGGAAAGAATCCAGGG + Intergenic
1186040251 X:5468907-5468929 CCTGTGGTAGAAAGAAACCCTGG + Intergenic
1186636292 X:11408741-11408763 ACTCTGGTAGGAAGAACTCATGG - Intronic
1187325938 X:18288459-18288481 TTTATGGTAGAAATAACCAAAGG + Intronic
1198740285 X:139835071-139835093 CCACTGGTAGAAAAAACACATGG + Intronic
1201774403 Y:17647827-17647849 CCTATAGTAGAAAAAAGACAGGG - Intergenic
1201827153 Y:18258162-18258184 CCTATAGTAGAAAAAAGACAGGG + Intergenic