ID: 1028215386

View in Genome Browser
Species Human (GRCh38)
Location 7:88125919-88125941
Sequence CCTTGGGTTCTTTCTACCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028215384_1028215386 -10 Left 1028215384 7:88125906-88125928 CCTGCTTGTGGCACCTTGGGTTC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1028215386 7:88125919-88125941 CCTTGGGTTCTTTCTACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028215386 Original CRISPR CCTTGGGTTCTTTCTACCAT AGG Intronic
No off target data available for this crispr