ID: 1028215387

View in Genome Browser
Species Human (GRCh38)
Location 7:88125935-88125957
Sequence TGGGCAAGGAAAGAAGCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028215387_1028215390 -4 Left 1028215387 7:88125935-88125957 CCATAGGCTTCTTTCCTTGCCCA 0: 1
1: 0
2: 0
3: 21
4: 271
Right 1028215390 7:88125954-88125976 CCCAGATATGTACCACATCGTGG No data
1028215387_1028215393 11 Left 1028215387 7:88125935-88125957 CCATAGGCTTCTTTCCTTGCCCA 0: 1
1: 0
2: 0
3: 21
4: 271
Right 1028215393 7:88125969-88125991 CATCGTGGAATCCACTTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028215387 Original CRISPR TGGGCAAGGAAAGAAGCCTA TGG (reversed) Intronic
900469912 1:2848608-2848630 TGGGTAGGGACAGAAGCCAAGGG + Intergenic
901459786 1:9384582-9384604 AGGGGAAGGAGAGAAGCCTCCGG - Intergenic
901807311 1:11746915-11746937 TGGGCAAGGGAAGGAGTCTCAGG + Intronic
902684442 1:18066828-18066850 TGGGCTAGGCAAGGAGCCTCCGG - Intergenic
903701394 1:25251067-25251089 AGGGCAGGGAAAGAACTCTAGGG + Intronic
903801710 1:25973660-25973682 TGAGCAAGGGAAGAAGCCACTGG + Intronic
904694529 1:32321326-32321348 TGATCAAGGAAAGATGCCCAAGG - Intronic
904787386 1:32993029-32993051 TGGGCCAGGAAAATAGCCTTTGG + Intergenic
904814262 1:33183152-33183174 TGGGTAAGGAGAGAAGACTAGGG + Intergenic
904852499 1:33469391-33469413 AGGGCAAAGAGAGAAGCCTTTGG + Intergenic
906830654 1:49027860-49027882 TGGGCAAGACAAGAAGACCAGGG + Intronic
908339498 1:63161970-63161992 TGGGAAAGGGAAGAAGGGTAGGG + Intergenic
908459412 1:64334827-64334849 TTGTAAAGGAAAGAAGCCCATGG - Intergenic
909519138 1:76547132-76547154 TGGTTTAGGCAAGAAGCCTATGG - Intronic
909998987 1:82319128-82319150 ACGGCAAGGAAAGAGGCCTCTGG - Intergenic
912453113 1:109779519-109779541 TGGGCCAGGGCAGAAGGCTATGG - Intergenic
913388774 1:118287790-118287812 AGGGTAAGAAAAGAAACCTAAGG - Intergenic
915281722 1:154827353-154827375 TGTGGAGGGAAAGAAGCCTCAGG - Intronic
915296443 1:154924968-154924990 TGGGCAAGGCAGGAAACCTCTGG - Exonic
915949812 1:160181610-160181632 TGGGAGAGGAAAGAAGCCTTAGG + Intronic
918444637 1:184605077-184605099 TGGACAAGGAAAGAAACCCAAGG + Intronic
918663727 1:187121358-187121380 TGGGAAAGGAAAAAAACCTAAGG - Intergenic
918827138 1:189338660-189338682 TGGGCAGAGCAATAAGCCTAGGG + Intergenic
922005575 1:221527435-221527457 TGGGCAAGGAAACAAGAGAAAGG - Intergenic
922059986 1:222079615-222079637 TGGGCAAGGAAAGGTGCTTCAGG + Intergenic
922948747 1:229539942-229539964 TGGGCAAGGACACCAGCCTGAGG + Intronic
1065438214 10:25722918-25722940 TGCGCATGAAAAGAATCCTAAGG + Intergenic
1066531904 10:36350190-36350212 TGGGCAGTGAAGGAAGCCAAGGG - Intergenic
1066787658 10:39023454-39023476 TGGGCACTGAAATAGGCCTATGG - Intergenic
1066977037 10:42378570-42378592 TGGGGAAGGCAAGAAGCTCAGGG + Intergenic
1068151248 10:53135201-53135223 AGGGAAATGAAACAAGCCTATGG + Intergenic
1073864486 10:107786434-107786456 TTATCAAGGAAAGAAGCTTAAGG - Intergenic
1074650485 10:115518131-115518153 AGTGCAAGGAAAGAACACTAAGG - Intronic
1076176591 10:128372955-128372977 GGGGCAAGGAAAGAGGCCCAGGG + Intergenic
1077446961 11:2599667-2599689 AAGGCAAGGAAAGAGGCCTCAGG - Intronic
1079955876 11:26864161-26864183 TGGGCTTGGAAAGAGGCATAGGG - Intergenic
1080515963 11:33020545-33020567 TAGGCAAGAAAGGAAGCATATGG - Intronic
1080760833 11:35247462-35247484 TGAGCAAGGAGAGAAGACTGTGG - Intergenic
1080787048 11:35484851-35484873 TGGCCAAGGAACTCAGCCTAGGG + Intronic
1081691902 11:45084218-45084240 GGGTAAAGGAAAGAAGCCTCTGG - Intergenic
1081965738 11:47168356-47168378 TGGGTAAGGACAGAAGGCTCTGG - Intronic
1082303539 11:50541997-50542019 TGGGCATGCATAGAAACCTATGG - Intergenic
1082588544 11:54974807-54974829 TGGGAATGGATAGAGGCCTATGG + Intergenic
1083238934 11:61371402-61371424 AGGGAAAGGAAAAAAGCCTCAGG + Intergenic
1085715249 11:78866822-78866844 TGGGTAGGGAAGGAAACCTAGGG + Intronic
1090603181 11:128393663-128393685 TGGCCAAGGACAGAAGCCTTTGG - Intergenic
1090643747 11:128750581-128750603 GGGGCAAGGAAAGAAGAAGAGGG - Intronic
1090713954 11:129413649-129413671 TGGTCAAGGCATGAAGCTTAGGG + Intronic
1091360714 11:134976814-134976836 GGGGCAAGGAGAGGAGCCTCAGG + Intergenic
1091786559 12:3246505-3246527 TGGGCAGGGAAAGAGGCAGATGG + Intronic
1096648448 12:53050365-53050387 TGGGCCAGGGAAGAAGGCTGAGG - Intronic
1098650282 12:72958045-72958067 TTGGCAAGTAAAGAAGCCAGAGG + Intergenic
1099560122 12:84162662-84162684 TGGGGAACTAAAGAAGCATATGG + Intergenic
1100229264 12:92590749-92590771 TAAGCAAGGAAAGAAGCCATGGG + Intergenic
1100360202 12:93870678-93870700 TGGGCAAGCCAAGAAGACCAGGG + Intronic
1101763670 12:107679756-107679778 TGGGAAGGAAATGAAGCCTATGG - Intergenic
1103015865 12:117494116-117494138 TGGCCATGGGAAGCAGCCTAAGG - Intronic
1104411391 12:128561062-128561084 GGGGGAAGGAAAGAAGCCATGGG - Intronic
1104605624 12:130185436-130185458 TGGGAAAGGAGAGAAGCTTTCGG + Intergenic
1106026887 13:25964029-25964051 AGGGCAAGCAAGGAAGGCTAAGG + Intronic
1107080969 13:36374388-36374410 AGGGCAAGGGAGGTAGCCTAGGG + Intergenic
1108722020 13:53141939-53141961 TGGGCAAGGTATTAAGCCAAGGG - Intergenic
1109594620 13:64533827-64533849 AGGACAAGGAAAGAAGCAGATGG - Intergenic
1109609012 13:64739001-64739023 TGGGGAAGGCAAGAAGCTCAGGG - Intergenic
1110511943 13:76361302-76361324 TGGGCAAGGGAATCTGCCTATGG + Intergenic
1112105549 13:96235764-96235786 TGGGGAAGGAAATAAGACTTTGG - Intronic
1117424662 14:55580961-55580983 TGGGCACGGAAAGCAGCATGAGG + Intronic
1119201347 14:72755117-72755139 TGGGGAACGAAGGAAACCTAAGG - Intronic
1119216807 14:72875696-72875718 TATGCAAGGAACGAACCCTAAGG + Intronic
1119740941 14:77013402-77013424 TGGGCAAAGAAAGAGCCCTGTGG + Intergenic
1120499051 14:85271268-85271290 GGGGCAAGGAAAAAAGCCACAGG - Intergenic
1123137868 14:106046396-106046418 CAGGCAAAGAAAGAAGGCTACGG + Intergenic
1124212962 15:27778467-27778489 TGTGCAAGGAAAGGGGCCCAGGG - Intronic
1124393300 15:29278934-29278956 AGGCCAAGGAGAGAAGCCTCAGG - Intronic
1125650912 15:41316996-41317018 TGGTCAAGGAAAGACTTCTAAGG + Intronic
1126741096 15:51776802-51776824 TGTGCAAGGAAAGAGGACTCAGG + Intronic
1126894427 15:53243021-53243043 TGGGGAAGGGAAGATGCCTCTGG + Intergenic
1128702068 15:69812266-69812288 TGGGCAAGTAACTAAGCCTCAGG - Intergenic
1129059415 15:72848980-72849002 TTGGAAAGGGAAGAAGCCAATGG + Intergenic
1129953749 15:79614650-79614672 TGGGAAGGGAATGAGGCCTAGGG + Intergenic
1130283544 15:82537528-82537550 TAGGCAGGGCAAGAAGCCAAGGG + Intronic
1130897515 15:88182693-88182715 TGGGCATGAAAGGAAGCCTGGGG - Intronic
1131136956 15:89944428-89944450 TGGGAAAGGCAAGAAGCCCATGG - Intergenic
1131959663 15:97775407-97775429 TATCCAAGGAAAGAAGCATATGG + Intergenic
1131968934 15:97873405-97873427 AGGCCAAGGAGAGAAGCCTCAGG - Intergenic
1131971129 15:97893946-97893968 TAGGCAGGGAAAGAAGGATAGGG - Intergenic
1131982413 15:98006988-98007010 TGGGAAGGAAAAGATGCCTATGG - Intergenic
1133110063 16:3542780-3542802 TGGGAAAGACAGGAAGCCTAAGG + Intronic
1133229311 16:4359207-4359229 TGGGCAAGTACAGGAGCCTGTGG - Intronic
1133449403 16:5891149-5891171 TGTGCAAAGAAAAAATCCTAAGG - Intergenic
1134598599 16:15515447-15515469 TGGCCAAGGAAAGAAGTGTGTGG + Intronic
1136999443 16:35216389-35216411 TGGGCAGGGACAGAGGCCAATGG - Intergenic
1137003509 16:35251617-35251639 TGGGCAGGGACAGAGGCCAACGG + Intergenic
1138309735 16:56013230-56013252 TGGGGGAGGAAAGAAGTCCATGG - Intergenic
1139007001 16:62584933-62584955 TGGGCAAGGTAAGCATGCTATGG + Intergenic
1140656223 16:77142936-77142958 TGGGGTAGGGAAGAAGCGTAGGG + Intergenic
1142768431 17:2079363-2079385 AGAGCAAGAAAAGAAGCATAAGG + Intronic
1143875567 17:9988201-9988223 AGGGCAAGGAGAGAAGCCATGGG - Intronic
1144047030 17:11463179-11463201 TGGATAAGGAAACAAGCTTACGG - Intronic
1144413541 17:15023977-15023999 TGGGCCAGGAAAGAATTCAAAGG + Intergenic
1144560208 17:16315114-16315136 TGGGCAGAGAAAGAACCCAAGGG + Intronic
1145922356 17:28619628-28619650 AGGGCAAGGAAAGAATGCTGGGG + Intronic
1146077088 17:29741371-29741393 TGGGCAAAGATTGAAGCATAAGG + Intronic
1146494764 17:33311767-33311789 AGGGTTAAGAAAGAAGCCTAGGG - Intronic
1146937065 17:36818588-36818610 TGGGACAGGAAAGAAGACTGTGG + Intergenic
1147016398 17:37495202-37495224 TGGGCGAGGGAGGAGGCCTAGGG + Intronic
1149534593 17:57422911-57422933 TGGACAAAGAAAGAAACCCATGG - Intronic
1149945677 17:60922843-60922865 GGGTCAAAGAAAGAAGCTTAGGG + Intronic
1150732916 17:67711401-67711423 TGAGCCAGGAAAGAAGGGTAGGG + Intergenic
1150952759 17:69821604-69821626 TGGGCATGGGAGGAAGCTTAGGG + Intergenic
1150978047 17:70110858-70110880 TCGGCAAGGAAAGAGGTCAAAGG - Intronic
1152720818 17:81923122-81923144 TGGGCAGGGACAGGAGCCTGTGG - Intronic
1153788443 18:8555834-8555856 TGTGCAAGGTGAGAGGCCTATGG - Intergenic
1157122494 18:44924706-44924728 TTGGCATGGAAACAACCCTAGGG - Intronic
1157437714 18:47685130-47685152 TGGGGAAGCAAACAAGCGTAAGG + Intergenic
1158923899 18:62230096-62230118 TGGGAAGGGAAAGAAGTATATGG + Intronic
1159277411 18:66238752-66238774 TGGACAAGGAAAGATGGCTGTGG + Intergenic
1159808787 18:72990916-72990938 TGGTCAAGGACAGAACCCTCTGG - Intergenic
1161515828 19:4695712-4695734 TGTGCCAGGAAGGAAGCCTGTGG - Intronic
1164068956 19:21748366-21748388 GGGGCAGGGAAAGGACCCTATGG + Intronic
1164421640 19:28098899-28098921 TGGGCAGGAGAAGAATCCTAAGG + Intergenic
1164675641 19:30098671-30098693 AGGGGCAGGAAAGAAGCCCAAGG - Intergenic
1164692961 19:30224524-30224546 TAGGCAAGGAAATTAGCATACGG - Intergenic
1165476884 19:36035774-36035796 TGGGAAAGGAAAGAAGGGTGGGG + Intronic
1165756206 19:38294607-38294629 TGGTCAAGGAAAGCAGCAGAAGG - Intronic
926913341 2:17871648-17871670 GGGGCAAGGAAGGGAGCCCAAGG - Intergenic
927237251 2:20885509-20885531 GGGGAAAGAAAAGAGGCCTAAGG + Intergenic
927693056 2:25221941-25221963 AGGGAAAGGTAGGAAGCCTAGGG + Intergenic
928105860 2:28470223-28470245 TTGGCATGGGAAGAGGCCTAAGG - Intronic
930641788 2:53860293-53860315 CGGGCAGGGTAAGCAGCCTAGGG - Intergenic
931484388 2:62675580-62675602 TGGGGAAAAAAGGAAGCCTAGGG + Intronic
931516022 2:63051178-63051200 TGGGAAAAGAAAGAAACCTGGGG + Intronic
933274086 2:80265451-80265473 TGGGAATGGAAAGATGCATAGGG + Intronic
933686849 2:85148306-85148328 TGTGGAAAGAAAGAAGCCCAAGG + Intronic
935496785 2:103792119-103792141 GAGGCAAGGAAAGCAGGCTAAGG + Intergenic
937438441 2:121897731-121897753 TGGCCAAGGAGAGCAGCCTCAGG - Intergenic
938344314 2:130556569-130556591 TGGGCAACGCAAGAAGTCTGAGG + Intergenic
938345519 2:130564153-130564175 TGGGCAACGCAAGAAGTCTGAGG - Intergenic
939553798 2:143649305-143649327 TGGACAAGGAAAGAAAACTTTGG + Intronic
939877809 2:147597835-147597857 TGGGCATGTAAAGGAGCCTATGG - Intergenic
940049713 2:149449330-149449352 TGAGAAAGGAAACAATCCTATGG - Intronic
943830190 2:192451074-192451096 GGGGAAAGGAAAGAATTCTAAGG - Intergenic
945201983 2:207291136-207291158 TGGGAAAGGAAAGAAGGTGATGG - Intergenic
946105065 2:217361903-217361925 TTGGCAAGGAAAGAAGTGTATGG + Intronic
946575853 2:221074548-221074570 TGACCAAGGAAAGAAGCCCCGGG - Intergenic
947032101 2:225807968-225807990 TGAGGAAGGAAAGAAGTCAACGG + Intergenic
949005154 2:241641790-241641812 TGGGAAAGAAAAGAGGCCAAAGG + Intronic
1169087524 20:2836547-2836569 TGGGCAAACAAAGAAGGCTCTGG - Intronic
1172987858 20:39007444-39007466 TGGGCAGGGAAAACAGCCCAAGG - Intronic
1173606420 20:44335276-44335298 TGCATAAGGAAAAAAGCCTAGGG - Intergenic
1174215344 20:48912088-48912110 TGGGAAGGGAAGGAAGCCTGAGG + Intergenic
1174738184 20:52985236-52985258 TGGGAAAGCAAAGATGCCTGAGG - Intronic
1175625394 20:60484879-60484901 TGGGGGAGGAAAGAGGCCCAAGG - Intergenic
1175704726 20:61168216-61168238 TGTGCAGGGACAGAAGCCTGGGG - Intergenic
1175874477 20:62222884-62222906 TGGGCAAGGACAGGGGCCTCTGG - Intergenic
1177059223 21:16350553-16350575 TGGGCAATGAAAAAATGCTATGG - Intergenic
1177230970 21:18319224-18319246 TGGGCAAAGAAATTAGCCTGAGG + Intronic
1180997474 22:19972605-19972627 AGGGCAGGGAAAGTGGCCTATGG + Intronic
1182585227 22:31341129-31341151 TAGGCAAGGACAGATGCCCAGGG + Intronic
1182594297 22:31406392-31406414 TGCAGAATGAAAGAAGCCTATGG - Intronic
1182691103 22:32163811-32163833 TGAGCAAGGAAACAAGGCTTGGG + Intergenic
1182790659 22:32950099-32950121 TGGGCAGGGGAACACGCCTAAGG - Intronic
1182799344 22:33018749-33018771 TGAGCAAGGAAAGAAGTTTGGGG - Intronic
1183393068 22:37556791-37556813 TGGCCAAGGCAAGGGGCCTAAGG - Intergenic
1183567082 22:38623263-38623285 TGGGCTAGGATAGGTGCCTAAGG + Exonic
1183828387 22:40405498-40405520 AGGCCAAGGAAAGCAGCCCAGGG + Intronic
1184116480 22:42425651-42425673 TGGTCAAGGCCAGAAGCCTCAGG - Intronic
1184125279 22:42482434-42482456 TGGGCCAGGGAGGACGCCTAGGG - Intergenic
1184133764 22:42533894-42533916 TGGGCCAGGGAGGAGGCCTAGGG - Intergenic
1184629996 22:45769645-45769667 TGGTCAAGAAAAGAAGACCAAGG + Intronic
1184737288 22:46406707-46406729 TGGGCAGGAAAAGAACCATAGGG + Intronic
950247090 3:11430931-11430953 AGGGAAGGGCAAGAAGCCTAGGG + Intronic
950366058 3:12484858-12484880 TAGTCAAGGAAAGAAGCAAAGGG + Exonic
951462669 3:22968297-22968319 TGGGAAAGGAAAGGAGGATATGG + Intergenic
952425996 3:33174871-33174893 TGGGAAAGGTAAGCAGCCCAGGG - Exonic
953341822 3:42140808-42140830 CGGGCCAGCCAAGAAGCCTATGG - Intronic
953435035 3:42871401-42871423 TGGGCCAGGAGAGTGGCCTATGG - Intronic
955181601 3:56676479-56676501 TTGGCAAGGAAAGCAGCATGTGG + Intronic
960048639 3:113220558-113220580 TGGGTAAGCACAGAAGCCAATGG - Intronic
960536894 3:118824784-118824806 AGGGCAAGCAAAGATACCTAAGG + Intergenic
960617307 3:119607695-119607717 AGAGCAAGGAGAGATGCCTAAGG - Intronic
960864180 3:122183928-122183950 TGGCGATGGAAAGAAGCTTAGGG - Intronic
961351317 3:126306303-126306325 GGGAAAAGAAAAGAAGCCTAAGG + Intergenic
961922607 3:130443971-130443993 TGGGTCATGAAAGATGCCTAGGG - Intronic
962697521 3:137965031-137965053 TGGGCAAGGAGAGCTGCCTTGGG + Intergenic
963103102 3:141623972-141623994 ACAGCAAGGAAAGGAGCCTAGGG - Intergenic
963977829 3:151502379-151502401 TGGGTAAAGAAAAGAGCCTATGG + Intergenic
965904815 3:173690842-173690864 TGGTTAGGGAAAGAAGCCAAAGG + Intronic
966511838 3:180772902-180772924 TGGGCAATGACAGAAGCTAAAGG + Intronic
967284776 3:187858450-187858472 GAGGCAGGGAAAGAAGCCTTGGG - Intergenic
970871878 4:20825776-20825798 TGGTCAAGAACAGAACCCTAAGG + Intronic
971143604 4:23951459-23951481 TGGGAAAGGAAAGAATCCTTTGG - Intergenic
972854655 4:43092329-43092351 TGGGAAAGGCAAGAATCCTAAGG + Intergenic
974043801 4:56880478-56880500 TGGGAAAGGAAAGAGGTCCAGGG + Intergenic
974321100 4:60351068-60351090 AGGGTAAGGAATTAAGCCTAAGG + Intergenic
976267028 4:83194403-83194425 TGGGCAATGAGAGAAGAATATGG - Intergenic
976459539 4:85293258-85293280 TGTGCTAGGAAAGGAGCCTGGGG - Intergenic
976846849 4:89498565-89498587 TGTGCAGGGAAAGAATTCTATGG - Intergenic
978069533 4:104450287-104450309 TGAGCAAGGAAAGAAGTAGAAGG - Intergenic
978866461 4:113518562-113518584 TGAGCTAGGAAAGAAACCAAAGG - Intronic
979514189 4:121588188-121588210 AAGCCAAGGAAAGAATCCTAGGG - Intergenic
979747728 4:124238746-124238768 TGGGCAAGGATAGGAGGCTAAGG - Intergenic
980146526 4:128992377-128992399 AAGGCAAGGAAAGAAGGCCAAGG - Intronic
980357168 4:131737101-131737123 GGGGCAAGGAAAGATCCCCAGGG - Intergenic
980357710 4:131739596-131739618 GGGGCAAGGAAAGATCCCCAGGG - Intergenic
980358780 4:131744576-131744598 GGGGCAAGGAAAGATCCCCAGGG - Intergenic
980359320 4:131747049-131747071 GGGGCAAGGAAAGATCCCCAGGG - Intergenic
980360403 4:131752012-131752034 GGGGCAAGGAAAGATCCCCAGGG - Intergenic
980361486 4:131756967-131756989 GGGGCAAGGAAAGATCCCCAGGG - Intergenic
980362569 4:131761922-131761944 GGGGCAAGGAAAGATCCCCAGGG - Intergenic
982197412 4:152930176-152930198 TGGGGTAGGTAGGAAGCCTAGGG + Intergenic
985225582 4:187757828-187757850 TGGGGAAGAATAGAAGACTATGG - Intergenic
985903474 5:2814760-2814782 TGGACAATGAAGGAAGCCTTTGG + Intergenic
987367799 5:17164866-17164888 TAGGCAAGCAAAGAACCCAAAGG - Intronic
988326610 5:29776786-29776808 TGGGGAGGGAAAGTATCCTATGG + Intergenic
988984399 5:36602766-36602788 TGAGCAAGGGCAGAAGCCTAGGG - Intergenic
990431409 5:55738412-55738434 TGGGGAAGGGAAGAAGGGTATGG - Intronic
990454939 5:55975918-55975940 TGGGGAAGGAAAGAAGTGTGTGG - Intronic
990995644 5:61729857-61729879 TGGGCAAGGAGGGAAGTGTAGGG + Intronic
992200050 5:74374271-74374293 TGGGGATGGAAAGAAGACCACGG + Intergenic
993417398 5:87652410-87652432 TTGGCAAGGGAAGATGTCTATGG - Intergenic
995105085 5:108368293-108368315 TGGGAAGGGAAAAAAGACTAGGG + Intronic
995861340 5:116644096-116644118 GTTGCAAGGAAAGAAGCTTAGGG - Intergenic
998929850 5:147169305-147169327 TTGGAAATGAAAGAAGCCTCAGG + Intergenic
999333852 5:150698189-150698211 TGGATCAAGAAAGAAGCCTAAGG + Intronic
999378216 5:151101596-151101618 TGGTCATGGAGAGAAGCCGAGGG - Intronic
1001294151 5:170487156-170487178 TTGGCAGGGCAAGAAGCCTAGGG + Intronic
1001461498 5:171918999-171919021 GGGCCAAGGAAAGATGGCTAAGG - Intronic
1001646633 5:173287044-173287066 AAGGAAAGTAAAGAAGCCTAAGG - Intergenic
1001663404 5:173413211-173413233 AGGGCAGGGGAAGAAGCCAAGGG + Intergenic
1001791201 5:174459283-174459305 TGGGCAGGGAAGGAAGCCAATGG - Intergenic
1002389475 5:178898587-178898609 TGGGGAGGGACAGAAGCCAAAGG - Intronic
1005130891 6:22506647-22506669 TCTGCAAGGAAAAAAGCCAAAGG - Intergenic
1005681400 6:28212169-28212191 TCAGCAAGAAAAGAAGCCTGAGG - Intergenic
1005695758 6:28351308-28351330 TGGGGAAGGGAGGAAGTCTATGG - Intronic
1005784336 6:29227606-29227628 TGGGGAAGGAAGGAGCCCTAAGG - Intergenic
1006068130 6:31477292-31477314 TGGAAGAGGAAAGAAGGCTAAGG + Intergenic
1007594527 6:43043360-43043382 TGGGGATGGACAGAAGCCTGTGG + Intronic
1007828364 6:44618789-44618811 GGGGAAAGGAAAGAGGCCTGAGG - Intergenic
1008048131 6:46872655-46872677 TGGGAAAGGAAAGAAAGGTATGG - Intronic
1008435041 6:51466317-51466339 TGGTGAAGGAAAGAAAGCTAGGG + Intergenic
1008469958 6:51873657-51873679 AGGGTAAGGAAAGAAGCTAAAGG + Intronic
1014215461 6:118748731-118748753 TGGAGAAGGAAAGCTGCCTAGGG + Intergenic
1015220066 6:130794307-130794329 TGGGCAAGGTAAGAAGGCTTAGG + Intergenic
1015930947 6:138359404-138359426 TGGGCAAAGACAGAAGGCTGGGG + Intergenic
1016990228 6:149923319-149923341 GGGTCATGGAAAGAAGCCTTTGG - Intergenic
1017756508 6:157533703-157533725 TGGGCACGGAGTGCAGCCTAGGG + Intronic
1017810455 6:157980630-157980652 TGGGCAAGGAAAGGGGCTAAGGG + Intergenic
1018067069 6:160131671-160131693 GAGCCAAGGAAAGAAGCCAAGGG - Intronic
1018469788 6:164085235-164085257 TGGGCAAGGACAGAAGCACACGG - Intergenic
1019868304 7:3734055-3734077 TGGGCAAGGAAAGGAGCTGTGGG - Intronic
1022182917 7:27939570-27939592 TGGAGAAGGAAAAAAGCCTGAGG - Intronic
1024904589 7:54362182-54362204 AAGCCAAGGAAAGAAGCCTTGGG - Intergenic
1025573985 7:62611498-62611520 TGGGAAAGCATAGAGGCCTATGG - Intergenic
1025595691 7:62922290-62922312 TGGGAAAGCATAGAAGCCTATGG + Intergenic
1026686220 7:72512412-72512434 AAGTCAAGGAAAGAAGCCTTGGG + Intergenic
1027968920 7:85051527-85051549 AGGGCAAGGATAGAATCCAATGG - Intronic
1028215387 7:88125935-88125957 TGGGCAAGGAAAGAAGCCTATGG - Intronic
1029711773 7:102303746-102303768 AGGGCAGGGACAGAAGCCCAGGG + Intronic
1031564746 7:123281779-123281801 TCACCAAGGCAAGAAGCCTATGG - Intergenic
1032018278 7:128393186-128393208 TGGGGGAGGACAGAGGCCTAGGG - Intronic
1032465345 7:132140885-132140907 TGGAGAAGGAGAGAAGCCTGGGG + Intronic
1033449154 7:141447583-141447605 TTGCCCAGGAAAGAAGCCCAGGG - Intronic
1033797264 7:144861615-144861637 TGAGCAGGGATAGAAGCATATGG - Intergenic
1035892375 8:3359082-3359104 TAGCCCAGGCAAGAAGCCTAGGG - Intronic
1037662163 8:20937251-20937273 TGGGAATGGGAAGAAGGCTACGG + Intergenic
1039449306 8:37658903-37658925 GGGGCAAGGAGAAAAGCCTATGG - Intergenic
1039805635 8:40995135-40995157 TTGGCAAGGAAAGCAGCGTGGGG - Intergenic
1040577768 8:48669144-48669166 TGGTCAAGGACAGAAGCTCAGGG - Intergenic
1044167496 8:89005095-89005117 TGGGCAAGGTATAAAGCCCACGG - Intergenic
1045315103 8:101037067-101037089 TGGGTAAGGACAGAATCCTAGGG + Intergenic
1047522892 8:125609130-125609152 TGGGCAAAAAGGGAAGCCTAGGG - Intergenic
1048369444 8:133764891-133764913 TGGGCAAGGAACGCACCCTCAGG - Intergenic
1048597615 8:135882803-135882825 TGTTCAAGAGAAGAAGCCTATGG + Intergenic
1049261554 8:141641737-141641759 TGGGCAAGGCAGGAAGCACAGGG + Intergenic
1050644928 9:7709058-7709080 ATGGCAAGGAAAAATGCCTAAGG + Intergenic
1051121260 9:13754944-13754966 TGGACAAGGAGGGAAGCATAGGG - Intergenic
1051333288 9:16044793-16044815 TTGGAAGGGAAAGAAGCCCAGGG + Intronic
1054449374 9:65395109-65395131 TGGGCAAGTGGAGAGGCCTAAGG + Intergenic
1059452246 9:114377637-114377659 TGGGGATGGAAAGAATCCCAAGG + Intronic
1061572816 9:131488125-131488147 TCGTGAAGGAAAGAAGCCTAGGG - Intronic
1061616367 9:131782483-131782505 AGGGGAAGGAAAGGAGCCAAGGG - Intergenic
1186491837 X:9979857-9979879 TGGGCCAGAAAAGGAGCCTCAGG + Intergenic
1187187874 X:17004541-17004563 AGAGCAAGGAAAGTAACCTATGG + Intronic
1187668763 X:21646849-21646871 TAGGCCAGGAAAGAACCCTGAGG - Intronic
1189987836 X:46569916-46569938 TGGGCAAAGGGAGAAGTCTATGG - Intergenic
1190420787 X:50282288-50282310 TGGGCTGGGAAGGATGCCTAAGG - Intronic
1190969710 X:55336695-55336717 TAGGCATGGAAAGAAGTATAGGG + Intergenic
1192167926 X:68837600-68837622 TAGGCAAGGACAGAGTCCTATGG + Intronic
1193189030 X:78547645-78547667 TTAACAAGGAAAGAAGCCTGAGG - Intergenic
1193329342 X:80218280-80218302 TGGCCAAGGATAGAATCATATGG + Intergenic
1197849016 X:130837033-130837055 TTGGAAAGGGAAGAAGCATATGG + Intronic
1199936702 X:152581719-152581741 TGAGCAAGAAAACAAGCCTCAGG - Intergenic