ID: 1028215390

View in Genome Browser
Species Human (GRCh38)
Location 7:88125954-88125976
Sequence CCCAGATATGTACCACATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028215385_1028215390 12 Left 1028215385 7:88125919-88125941 CCTTGGGTTCTTTCTACCATAGG 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1028215390 7:88125954-88125976 CCCAGATATGTACCACATCGTGG No data
1028215387_1028215390 -4 Left 1028215387 7:88125935-88125957 CCATAGGCTTCTTTCCTTGCCCA 0: 1
1: 0
2: 0
3: 21
4: 271
Right 1028215390 7:88125954-88125976 CCCAGATATGTACCACATCGTGG No data
1028215384_1028215390 25 Left 1028215384 7:88125906-88125928 CCTGCTTGTGGCACCTTGGGTTC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1028215390 7:88125954-88125976 CCCAGATATGTACCACATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028215390 Original CRISPR CCCAGATATGTACCACATCG TGG Intronic
No off target data available for this crispr