ID: 1028218323

View in Genome Browser
Species Human (GRCh38)
Location 7:88162764-88162786
Sequence ACTGGGGCCTGAATTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028218323_1028218328 25 Left 1028218323 7:88162764-88162786 CCTGTTTCAATTCAGGCCCCAGT 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1028218328 7:88162812-88162834 ACTTTATCAATTTCTCCAAAAGG 0: 1
1: 0
2: 5
3: 38
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028218323 Original CRISPR ACTGGGGCCTGAATTGAAAC AGG (reversed) Intronic
901751123 1:11409690-11409712 ACTGTGGCCTGATTAAAAACCGG + Intergenic
902304399 1:15525223-15525245 ACTGGTGCCAGAATTGCAAAAGG - Intronic
905939129 1:41848931-41848953 ACTGGTGCTTGAAGGGAAACTGG - Intronic
906692641 1:47802700-47802722 GCTGGGGCCTGAATTGAGGTGGG - Intronic
907698063 1:56754114-56754136 ACTGTGGCATTAATTGGAACAGG - Intronic
908351095 1:63286732-63286754 ACTGGGGCCAGCCTGGAAACTGG - Intergenic
908784297 1:67719897-67719919 AATGAGGCCTCAATTAAAACTGG + Intronic
911374390 1:97033582-97033604 ACTGGGGCTTATATTGAAATGGG + Intergenic
912401177 1:109394765-109394787 AATGTGGCTTGAAATGAAACAGG + Intronic
921665829 1:217869694-217869716 ACTGGTGCCTGAATTCCAAAGGG + Exonic
1063673568 10:8119415-8119437 AATGGGGCCTGTCTTGAAAATGG + Intergenic
1064244635 10:13658989-13659011 ACTGAGGCCTAAATTTATACTGG - Intronic
1066804021 10:39225026-39225048 ACTGAGGCCTAAGTTGAAATAGG + Intergenic
1066808984 10:39299911-39299933 ACTGAGGCCTACATTGAAAAAGG - Intergenic
1074141140 10:110673745-110673767 ACAGTGGCCTATATTGAAACTGG + Intronic
1082100876 11:48171974-48171996 ACTTTGGCCTGAATCAAAACAGG - Intergenic
1084264878 11:67999726-67999748 ACTGTGGCCTGAAGCCAAACGGG + Intronic
1085467282 11:76732825-76732847 ACAGAGCCCTGATTTGAAACTGG + Intergenic
1087976607 11:104557155-104557177 ACTGGGGACTGAGCTGAAACAGG - Intergenic
1088683928 11:112269222-112269244 AGTGGGACATGAATTGGAACAGG + Intronic
1090764575 11:129865473-129865495 CCTGTGGCCTTAATTTAAACAGG - Intronic
1092104124 12:5908871-5908893 ATTGGTGCCTGAATGTAAACAGG + Intronic
1092529410 12:9332097-9332119 ACTGTGGTCTCAACTGAAACTGG + Intergenic
1095072405 12:37869411-37869433 ACTGAGGCCTATATTGAAAAGGG - Intergenic
1096358455 12:50963038-50963060 GCTGGGGCCTGAAGTGAGCCGGG + Intronic
1096911051 12:54984159-54984181 AGTAGGGCCTGAAATGAAACCGG + Intronic
1098924988 12:76339489-76339511 ACTTGGGCATGAATTGAGAAAGG - Intergenic
1101839262 12:108316262-108316284 GCTGGGGCCTGAAGTGAAGAGGG - Intronic
1102919960 12:116784517-116784539 TCTGGGGCCTGGGTTGAACCAGG + Intronic
1104968734 12:132521588-132521610 ACAGGGGCATGAACTGAGACTGG - Intronic
1105628785 13:22140537-22140559 ACTGTGGTCTGCACTGAAACAGG - Intergenic
1107724611 13:43286024-43286046 ACTGCGGCCGGAGTTGAAATGGG + Intronic
1107960685 13:45555352-45555374 ACTTGGGCCTGCATTGAGAAGGG - Intronic
1113437314 13:110303336-110303358 ACTGGGGCCTCAGTTGGAGCTGG + Intronic
1114032220 14:18587535-18587557 CCTGGGGCCTGACTTCCAACTGG - Intergenic
1114076999 14:19166565-19166587 CCTGGGGCCTGACTTCCAACTGG - Intergenic
1114085161 14:19233003-19233025 CCTGGGGCCTGACTTCCAACTGG + Intergenic
1114668753 14:24398115-24398137 CCTTGGGCCTGAATAGAACCTGG - Intergenic
1115785790 14:36824400-36824422 ATTGGGTCCTCATTTGAAACTGG - Intronic
1119214923 14:72862159-72862181 ACTGGGACCTGGATGCAAACTGG - Intronic
1120236955 14:81903433-81903455 ACTGGTGCCAGACTAGAAACTGG + Intergenic
1121316594 14:92964587-92964609 GCTCAGGCCTGAATTTAAACTGG + Intronic
1121792797 14:96711706-96711728 GCCAGGGCCTGAATGGAAACGGG + Intergenic
1122439386 14:101719601-101719623 ACAGGGGCCAGACATGAAACAGG + Intergenic
1125822135 15:42640967-42640989 AGTTGGGACAGAATTGAAACTGG + Intronic
1126621378 15:50643354-50643376 ACTGGAGCCTGGATTTTAACTGG - Exonic
1127653829 15:61036535-61036557 ACTGGGCCCTTAATTGGAGCAGG + Intronic
1128671105 15:69575394-69575416 ACTGAGGACTGAATTTTAACAGG + Intergenic
1131278591 15:91002957-91002979 AGGGAGGCCTGAATGGAAACAGG + Intronic
1131977769 15:97962370-97962392 ACTGGGGCCTGGGTTGATCCTGG - Intronic
1137236866 16:46624337-46624359 ACTGGGGCTGAAATTCAAACGGG + Intergenic
1138352480 16:56353301-56353323 ACTGGGGCCTGACTTGGGAGTGG + Intronic
1140289570 16:73640137-73640159 CCTGGGGCCTGCAATGGAACTGG + Intergenic
1142121688 16:88389699-88389721 AATGGGGCCAGGATTCAAACTGG + Intergenic
1144302458 17:13934589-13934611 ACTGGGTCCTGAATGGAATCAGG + Intergenic
1145267835 17:21388964-21388986 CTTGGGGCCTGGATTGACACGGG + Intronic
1148539786 17:48471234-48471256 ACTGAGGCAGGAATTGAACCTGG + Intergenic
1158616270 18:58990673-58990695 GCTGGGACCTTAATTGAAACAGG - Intergenic
1158899573 18:61950135-61950157 GCTGGAACCTGAATTGAAACTGG + Intergenic
1160720190 19:593831-593853 GTTGGTGCCTGAATTGGAACAGG + Intronic
1160736888 19:667073-667095 ACGGGATCCTGAATTGAAAAAGG - Intergenic
1164360859 19:27507697-27507719 ACTGAGGCCTGTAGTGAAAAAGG + Intergenic
1164965502 19:32479686-32479708 TCTGGGGCTGGAATGGAAACAGG - Intronic
1165246959 19:34503347-34503369 ACTGGGGCCTGACTTCATAGAGG - Exonic
1165739769 19:38198220-38198242 ACAGAGGCCTGACTTCAAACAGG - Intronic
1167954661 19:53055121-53055143 ACTGGGGCCTGGATTGGAGATGG - Intergenic
1167983580 19:53297046-53297068 ACAGAGGCCAGAATGGAAACAGG - Intergenic
927654345 2:24932835-24932857 AGTGGGACCTGGATTCAAACTGG - Intergenic
927706123 2:25297459-25297481 ACTGGGCCCTGCAGTGGAACAGG + Intronic
932566968 2:72916703-72916725 ACTGTGGCTTAAATTGAAGCTGG - Intronic
934118968 2:88822290-88822312 ACTGGGGCCTGAGGTCACACAGG + Intergenic
934956971 2:98631278-98631300 AGAGGGGCCTGAATTTAAATGGG - Intronic
936656405 2:114493207-114493229 AGTGGAGCCGGGATTGAAACTGG - Intronic
939008859 2:136821504-136821526 ACTGGTGGCTGAGTTGGAACAGG + Intronic
939036902 2:137143255-137143277 ACTGGGGACTATATTAAAACAGG - Intronic
940377104 2:152969244-152969266 AATGGGGCCTGAACTCAGACTGG + Intergenic
944105218 2:196072321-196072343 ACTGGGGACTGAATGGATTCAGG + Intergenic
944402883 2:199348642-199348664 ACTGGGGACAGAATTGAGATAGG - Intronic
946311920 2:218886739-218886761 GCTGGGGCCAGAACCGAAACTGG + Intronic
946830942 2:223727552-223727574 ACTGAGGCCTGAATTGGGGCAGG - Intergenic
947079534 2:226380703-226380725 ACTGGGGCCTGGAAAGAAAAAGG + Intergenic
948393943 2:237631111-237631133 GTGGGGGCCTGAATGGAAACTGG + Intronic
1171575713 20:26312788-26312810 ATTGAGGCCTAAAGTGAAACAGG + Intergenic
1171780521 20:29412194-29412216 ACTGTGGCCTGTTTGGAAACTGG + Intergenic
1172351613 20:34247233-34247255 ACATGGTCCTCAATTGAAACAGG + Intronic
1173927408 20:46791120-46791142 ACTGGGGATTGCATTGCAACAGG + Intergenic
1178329855 21:31678677-31678699 AAGGGGGCCTGAATTGAGATGGG - Intronic
1180142744 21:45902156-45902178 AGTGGGTCCTGAGTTGGAACTGG + Intronic
1180292810 22:10860190-10860212 CCTGGGGCCTGACTTCCAACTGG - Intergenic
1180456334 22:15514592-15514614 CCTGGGGCCTGACTTCCAACTGG - Intergenic
1180495617 22:15889612-15889634 CCTGGGGCCTGACTTCCAACTGG - Intergenic
1183061511 22:35339020-35339042 ACCTGAGCCTGACTTGAAACTGG + Intronic
1184189108 22:42883096-42883118 ACTGGTGCCTGTATTAAAAGGGG + Intronic
1185091896 22:48780278-48780300 ACTGAGTCCTGAGCTGAAACTGG + Intronic
950592581 3:13949107-13949129 GCTGAGACATGAATTGAAACAGG + Intronic
954575800 3:51675464-51675486 ACTGGGGCACTAGTTGAAACAGG + Intronic
957084562 3:75668313-75668335 ACTGTGGCCTGTTTGGAAACTGG - Intergenic
957358864 3:79128228-79128250 ACCCAGGCCTGAATTGAAACAGG + Intronic
957936615 3:86951896-86951918 ACTGGGAACTGAATTCAAATAGG + Intronic
961637160 3:128340904-128340926 ACTGGAGCCTGGATTGGAGCAGG + Intronic
961641795 3:128369346-128369368 TCTGGGGTTTGAAATGAAACTGG + Intronic
961749985 3:129089034-129089056 ACTGGGGCTGAAATTCAAACGGG + Exonic
962694788 3:137937414-137937436 ACTGGGGCCAGAATCCTAACTGG + Intergenic
962863030 3:139422145-139422167 AAAGGGGCATGAATTTAAACAGG - Intergenic
967588011 3:191237866-191237888 ACTGGGGCATGAACAGGAACGGG - Intronic
969450867 4:7272525-7272547 TCTGGGGGCTTAAGTGAAACAGG + Intronic
973581331 4:52347230-52347252 GCTGGGACATTAATTGAAACAGG + Intergenic
974737221 4:65952266-65952288 CCAGGGGCCTGAATAGAAAAAGG - Intergenic
979973508 4:127167052-127167074 AATGAGGCCTGAATCAAAACAGG - Intergenic
985593504 5:777296-777318 ACTGAGGTCTGAATTGAAGCCGG - Intergenic
986215924 5:5719294-5719316 ACTGGGGGCTGAATGAAAACAGG - Intergenic
988615301 5:32769387-32769409 TCTCTGACCTGAATTGAAACTGG - Intronic
989835419 5:45982522-45982544 ACTGAGGCCTATATTGAAAAAGG + Intergenic
989853255 5:46242965-46242987 ACTGAGGCCTATATTGAAAAAGG - Intergenic
997338580 5:133124766-133124788 ACTGGGGACTGACTTAAGACAGG + Intergenic
1005848322 6:29800322-29800344 ATTTGGGCCTGAACTGAAAATGG - Intergenic
1005868525 6:29956485-29956507 ATTTGGGCCTGAACTGAAAATGG - Intergenic
1010613185 6:77981263-77981285 ACTGGGGCCTGTCTTGGGACAGG + Intergenic
1013062504 6:106648892-106648914 ACTGTAGCTTGAATTGAAAAAGG - Intronic
1014631385 6:123794673-123794695 ACTGAGCTCTGAATTGAAATAGG + Intergenic
1016794144 6:148099838-148099860 ACAGGTGCCTGCAATGAAACAGG + Intergenic
1017111744 6:150939201-150939223 ACTAGAGCCTGAATTGACAGAGG - Intronic
1023045395 7:36206006-36206028 TCTGGGGCCTGAATGCACACAGG - Intronic
1028218323 7:88162764-88162786 ACTGGGGCCTGAATTGAAACAGG - Intronic
1031644114 7:124202368-124202390 ACTGGTGCCTGGATTTATACAGG + Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1037902558 8:22695997-22696019 ACTGGGGCCTGAGTTGGGAAAGG + Intergenic
1038247198 8:25869887-25869909 ACTTGGGACTGCATTGAAAATGG - Intronic
1038294466 8:26278236-26278258 ACTGGGCCCTGTATGGAAAGAGG - Intergenic
1039115718 8:34089371-34089393 GCTGGGACATTAATTGAAACAGG - Intergenic
1040782297 8:51124052-51124074 ACTGGGGACTGAATTACAATGGG + Intergenic
1042059921 8:64805440-64805462 CCTGGGACCTGAACTGTAACAGG - Intergenic
1043233430 8:77830782-77830804 AATAGGGCCTGAAGTGAACCTGG + Intergenic
1045092903 8:98765482-98765504 ACAGGGCCCTGAATTGATAAGGG + Intronic
1045879050 8:107015600-107015622 ACTGGAGCCTGAATTTACATGGG - Intergenic
1052231647 9:26161420-26161442 AGTGGGGCAAGAATGGAAACAGG + Intergenic
1053950039 9:43363033-43363055 ACTGTGGCCTTTATTGAAAAAGG + Intergenic
1057497619 9:95573238-95573260 GCTGAGGCCAGAATGGAAACAGG + Intergenic
1057868802 9:98702372-98702394 GATGGGGCCTGAATGGAGACAGG - Intronic
1059641834 9:116224672-116224694 ACTGGGGCTTGAAATGTGACTGG + Intronic
1203593218 Un_KI270747v1:91234-91256 ACTGTGGCCTTTATTGAAAAAGG + Intergenic
1187393518 X:18901484-18901506 ACTGAGGAGTGAAATGAAACAGG - Exonic
1188507977 X:30903996-30904018 ACTGGGGAGTTAATTTAAACTGG + Intronic
1194495093 X:94605879-94605901 ACTGGGCTCTGAAATAAAACTGG + Intergenic