ID: 1028219635

View in Genome Browser
Species Human (GRCh38)
Location 7:88182030-88182052
Sequence TCTGAACCTCTAATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028219633_1028219635 2 Left 1028219633 7:88182005-88182027 CCTCGGTCTAATTCAACTGAGTA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1028219635 7:88182030-88182052 TCTGAACCTCTAATGGAAAAAGG 0: 1
1: 0
2: 1
3: 18
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028219635 Original CRISPR TCTGAACCTCTAATGGAAAA AGG Intronic
902082487 1:13830552-13830574 TCTGAAATTCAAATGGAAATGGG - Intergenic
903149849 1:21398927-21398949 TTCTCACCTCTAATGGAAAATGG + Intergenic
905570918 1:39004858-39004880 ACTGAACCTCTAAAGGGAAAAGG + Exonic
906086352 1:43138170-43138192 TCTAAACCTCTTATCTAAAAAGG - Intergenic
906304123 1:44705763-44705785 TCTGAACCACTATAGGGAAAGGG - Intronic
907806056 1:57821496-57821518 TTTAAACCTATAATGGGAAAGGG - Intronic
907942920 1:59106535-59106557 TCTGAACCTTATTTGGAAAATGG - Intergenic
909276778 1:73696872-73696894 TCTGGACCTCTAAATGAAAAAGG - Intergenic
910012110 1:82478123-82478145 TATTAACCTCTAATTGAAGATGG - Intergenic
910431567 1:87164785-87164807 TCTGGGCTTCTAATGGAAACAGG - Intronic
911249697 1:95560828-95560850 TTTTAACTTCTAAAGGAAAAAGG - Intergenic
911943110 1:104072424-104072446 TTTGATCCTTTAATTGAAAATGG - Intergenic
912845547 1:113071807-113071829 TCTGAAACTATAATGTAGAAAGG + Intergenic
914249947 1:145913737-145913759 TCTGGGCCTCTAAAGGAATAGGG - Intronic
915075489 1:153305121-153305143 ACTGATCCTCAAAAGGAAAAGGG + Intronic
919153148 1:193725475-193725497 TCTGGATGTCTTATGGAAAATGG - Intergenic
919153548 1:193731231-193731253 CATGAACCTCTAGTGGAGAAAGG + Intergenic
920544345 1:206803004-206803026 ACTGAACCTCAAAGGAAAAAAGG - Intronic
920679360 1:208060643-208060665 TCTGAAGCTCCCATGGGAAAAGG + Intronic
921078814 1:211722451-211722473 TCTGGAGCTCTCAGGGAAAAGGG - Intergenic
1064002285 10:11673687-11673709 TCCAAACCTCTGATGGAAACTGG + Intergenic
1064340487 10:14481086-14481108 TCTGAATTACTAATGGAAAAAGG + Intergenic
1065292838 10:24248123-24248145 ACTGATCCTATAATGGAAAAGGG - Intronic
1066708964 10:38212460-38212482 TCTGAACCTCTCATCAAAAAAGG + Intergenic
1067792345 10:49297928-49297950 TCTGAAGCTCTCAGGGCAAAAGG + Intergenic
1067978501 10:51054479-51054501 TCTGGAACTCTATTGGAATAGGG - Intronic
1068594221 10:58885320-58885342 TCTGAACCTCTAAGGCAGATTGG - Intergenic
1069725903 10:70578377-70578399 TCTCAACCTGTCATCGAAAATGG - Intergenic
1071685353 10:87749190-87749212 CCTGTACCTCTAATGCAGAAAGG + Intergenic
1073378523 10:103058535-103058557 TCTAAAAATCTTATGGAAAAGGG + Intronic
1074704667 10:116120213-116120235 GCTGAACCTCAAAAGGAAATTGG - Intronic
1079228220 11:18626821-18626843 ACAGAACCTCTATGGGAAAAAGG + Intronic
1079543327 11:21602622-21602644 TCTGACCCTTTAATGTAACAAGG + Intergenic
1081505065 11:43707604-43707626 TCTGCACTTCTAATAGAAGAGGG - Intronic
1082252512 11:49997324-49997346 TCTGAGCCACTATTGTAAAATGG - Intergenic
1085126832 11:74007694-74007716 TCTTAGCCACTCATGGAAAATGG + Intronic
1086906924 11:92429370-92429392 TCTTAACCTCAAATGTAAATGGG - Intronic
1087242041 11:95790578-95790600 GCTGAACCCCTGATGGAAAAGGG - Exonic
1088194339 11:107258546-107258568 TGTGGAACTCGAATGGAAAATGG - Intergenic
1092792492 12:12082041-12082063 TCTGAAACTCTAATGGGAAAAGG - Intronic
1093364766 12:18280275-18280297 TCTGATGATCTAACGGAAAAGGG + Intronic
1093574740 12:20713417-20713439 TTTAAACCTGTAATGTAAAAAGG + Intronic
1096909055 12:54963687-54963709 TGTGAAAATCTAAAGGAAAAGGG + Intronic
1097657940 12:62392050-62392072 TCTGAACCTTTAAAAAAAAAAGG - Intronic
1098018561 12:66131650-66131672 TTTGAAACTATAATGTAAAAAGG - Intronic
1098382407 12:69882732-69882754 TCTGAACCCCAAATGAAAAAAGG + Intronic
1098382419 12:69882793-69882815 TTTGAACCTCAAATACAAAAGGG + Intronic
1099274730 12:80560198-80560220 ACTGAACCTCCAAAGGATAAAGG - Intronic
1099621915 12:85012878-85012900 TCTGAACCTCTAAGGCAAACTGG + Intergenic
1101560023 12:105848126-105848148 TCTTAACCTTCAATGGAACAAGG + Intergenic
1102597632 12:114005126-114005148 TCTGAACCACCAATGCAAGATGG + Intergenic
1102993635 12:117332136-117332158 GCTGAAACTCTGATGGAGAAGGG + Intronic
1103060699 12:117856086-117856108 TCAGAAACCCTAATGGAAAAGGG + Intronic
1104082400 12:125441789-125441811 TCTGAATCTCTTCTGTAAAATGG + Intronic
1104543420 12:129687967-129687989 TCTGATCCTCTTAGGGAAAGGGG - Intronic
1105488151 13:20858480-20858502 ACTGAGCCTCTACTGGAAAAAGG + Intronic
1106789713 13:33142309-33142331 TGTGAACTTCCAAAGGAAAAAGG - Exonic
1108082438 13:46750657-46750679 TCTGAGCCCCCAATGGAGAAGGG - Intronic
1108796804 13:54042171-54042193 TCTACAGCTCTGATGGAAAAAGG - Intergenic
1110170090 13:72490259-72490281 TCTGAGCCAATAATTGAAAATGG + Intergenic
1111990873 13:95115881-95115903 TCAGGATCTCAAATGGAAAACGG - Intronic
1115434411 14:33356819-33356841 TAAGAACCTCTAATAGAGAAAGG + Intronic
1115901621 14:38157505-38157527 TCTGCACCTCTAATGAAAGCAGG - Intergenic
1116025012 14:39504785-39504807 TCTGCACATCTAATAGAATAGGG + Intergenic
1116131439 14:40859513-40859535 TCTGAAGCTCTAAGCAAAAAAGG - Intergenic
1117033265 14:51698126-51698148 TCTTAACCTGTAGGGGAAAAAGG - Exonic
1119058993 14:71454877-71454899 TCTGAACCTCCACAGTAAAAGGG - Intronic
1120152126 14:81048131-81048153 TCTTAACCTCAACTGAAAAAGGG - Intronic
1120174762 14:81281233-81281255 TCTGAAAATCGAAGGGAAAACGG + Intronic
1121368900 14:93338987-93339009 TCTGAACCTCTTCTGGTTAAGGG - Intronic
1121940564 14:98066484-98066506 TCTGAACATATGATGAAAAAGGG + Intergenic
1126259528 15:46672047-46672069 TTTGAACCACTGATGGAATATGG + Intergenic
1126568830 15:50128338-50128360 TCTGATGCTCTGATGGAGAAGGG - Intronic
1128709006 15:69858058-69858080 TCTGCACTTCTAATGGACATGGG - Intergenic
1132037938 15:98502085-98502107 TCTGAGCCTCACCTGGAAAATGG - Intronic
1132128923 15:99256041-99256063 TCAGTAACTCCAATGGAAAATGG - Exonic
1135874787 16:26188343-26188365 TCTGAACCTCCATTAGGAAAAGG - Intergenic
1137842701 16:51654492-51654514 TCTGAACCCTTGAAGGAAAATGG + Intergenic
1138103144 16:54270590-54270612 TCTGATCCTGTATTGGAAATGGG - Intronic
1138339759 16:56280948-56280970 TCAGAGCCTTTATTGGAAAAGGG + Intronic
1138888749 16:61114924-61114946 CCAGAACCTCTAAAGGACAAGGG + Intergenic
1140189809 16:72805756-72805778 TCTGAAACTCTACTGGCAAGAGG - Intronic
1143154589 17:4828103-4828125 TCTAAACCCAGAATGGAAAAAGG + Intergenic
1144707734 17:17380594-17380616 TCTGAGCCTCAACTGCAAAATGG + Intergenic
1144760048 17:17701968-17701990 ACTTGTCCTCTAATGGAAAAAGG + Intronic
1145006149 17:19339167-19339189 TCTCAAACTCTAATGAGAAAAGG - Intronic
1150621963 17:66814456-66814478 TCTGACCCTCTCATGGGACAAGG - Intergenic
1154174106 18:12072257-12072279 TCTCAACAGCTGATGGAAAAAGG - Intergenic
1154363942 18:13689116-13689138 GGTGAACCTCTGAAGGAAAAGGG - Intronic
1155847393 18:30726188-30726210 TCTGAATCTATAAGGGATAAGGG + Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163179388 19:15588190-15588212 TCAGTTCCTCTCATGGAAAAGGG - Intergenic
1164354776 19:27410764-27410786 TTTGAACCTATGGTGGAAAAGGG - Intergenic
1165168771 19:33875959-33875981 TCCAAACCCCAAATGGAAAATGG - Intergenic
1165675202 19:37717008-37717030 TCTGCACATCTAATGGGAACAGG + Intronic
1165930101 19:39352038-39352060 TCTGGCCCTTTAATGGAAGAGGG + Exonic
926014074 2:9433573-9433595 TCTGAACTTCTTAGAGAAAAAGG - Intronic
927849260 2:26488730-26488752 TCTGAGCCTCAACTGTAAAAGGG + Intronic
928524998 2:32130785-32130807 TTTGAGCCTCTCATGGAAAGAGG - Intronic
928645812 2:33351592-33351614 ACTGAAGGTCAAATGGAAAACGG - Intronic
930109035 2:47662499-47662521 TCTGAAGCTGAAAAGGAAAAGGG + Intergenic
933793133 2:85899539-85899561 TCTGAACATTCCATGGAAAAGGG + Intergenic
935620729 2:105127445-105127467 TCAGAACCTGTGAAGGAAAAGGG + Intergenic
937646676 2:124273501-124273523 TCTGAAACTCTAATTGTAAGGGG - Intronic
938740431 2:134226581-134226603 TCTGAACCACACATGTAAAATGG + Intronic
939064454 2:137465792-137465814 TCTGAACCACTAATGTCAAGTGG + Intronic
939328475 2:140726191-140726213 ACTGAACCACTAATAGCAAATGG - Intronic
939580257 2:143938205-143938227 TCTGCGGCTCAAATGGAAAAAGG + Exonic
941459777 2:165755593-165755615 ACTGAACCTTTAGTAGAAAAAGG + Intronic
944123470 2:196266939-196266961 TCTGAACCACAAAAGGCAAATGG - Intronic
944518039 2:200531996-200532018 TCTAAACCTCATGTGGAAAAAGG - Intronic
945252223 2:207773221-207773243 TCAGAACCTTTACTGGAAAAGGG - Intergenic
945713274 2:213328400-213328422 TCTATACTTCTAATTGAAAATGG + Intronic
947767868 2:232649006-232649028 GCTGAACCTCTGGTGGACAAAGG + Intronic
948236239 2:236393302-236393324 TCCCAACCTCTAAGGGACAAGGG + Intronic
1168737868 20:159235-159257 TCAGAACCTCTCCTTGAAAAGGG + Intergenic
1171251528 20:23652842-23652864 CCTGAAGGTCTTATGGAAAATGG + Intergenic
1171990457 20:31692415-31692437 TCTCAACCTTGAATGAAAAAAGG + Intronic
1177653649 21:23988288-23988310 TCTGAATAACTAATGGCAAATGG - Intergenic
1182038839 22:27220316-27220338 TCTAATGCTCTGATGGAAAAAGG + Intergenic
1182487978 22:30650660-30650682 TCTGGAGCTGTAATGGACAAAGG + Intronic
1183805046 22:40201726-40201748 TCTCAACCTGTATTTGAAAATGG - Intronic
951118228 3:18890968-18890990 TATGAAGCTCAAATGTAAAAAGG - Intergenic
953140826 3:40227890-40227912 TCTGCACCTCCATTGTAAAATGG - Intronic
954560926 3:51555924-51555946 TCTGAAACTAGAATGCAAAAGGG - Intronic
958863483 3:99472062-99472084 TCTGAGCCTGTGATGGAAGAAGG - Intergenic
958869348 3:99539031-99539053 ACTGTACATTTAATGGAAAATGG + Intergenic
960015181 3:112879270-112879292 TCTGAACCTAAAATAGAAGATGG - Intergenic
960729735 3:120713651-120713673 GCTGATCATCAAATGGAAAAAGG + Intronic
960795448 3:121481863-121481885 TATGTACCTCTAAATGAAAAGGG + Intronic
961279769 3:125757068-125757090 TCTGAATCACTATTGGACAAGGG - Intergenic
963009056 3:140752439-140752461 TGTCAACCTCCAGTGGAAAAAGG + Intergenic
963512624 3:146267850-146267872 TCTGAACCTTTTCTGGAAACTGG - Intergenic
963520051 3:146352833-146352855 TTTGGAACTCTAATGGAACAAGG + Intergenic
966316062 3:178646455-178646477 ACTGAACCTCTCAGGGACAAAGG + Intronic
967261835 3:187649980-187650002 CCTGAACCTCGGAAGGAAAATGG - Intergenic
968036137 3:195549636-195549658 TCTGAACCTAAAATGAAAAGAGG - Intergenic
970226177 4:13859403-13859425 ACTGAATTTCAAATGGAAAATGG - Intergenic
971153055 4:24054105-24054127 TTGAAATCTCTAATGGAAAAAGG + Intergenic
971625251 4:28911343-28911365 TCTTAACCTCTAATGTGAAGAGG + Intergenic
972783040 4:42302290-42302312 TCAGAGGGTCTAATGGAAAAGGG + Intergenic
974419713 4:61657821-61657843 TCTCAACCTCTGATGTCAAAAGG - Intronic
975959410 4:79883365-79883387 TAGAAACCTCTAATGGAAAAGGG + Intergenic
976962265 4:90992585-90992607 TCCGAAGCTCAACTGGAAAAGGG + Intronic
977589833 4:98813988-98814010 TCTGAACCGCAATTGTAAAATGG - Intergenic
977817353 4:101430311-101430333 TCTAAACCACAAAAGGAAAAGGG + Intronic
978553498 4:109953335-109953357 TTTGAGCCTCTAATAAAAAATGG - Intronic
979212861 4:118127016-118127038 TCTGAATAACTAATGGACAAAGG - Intronic
981223221 4:142261265-142261287 TATGAAACTGTAATGGAAAGAGG + Intronic
982033413 4:151323585-151323607 TCACACCCTTTAATGGAAAAAGG + Intronic
982490021 4:156018371-156018393 GCTGAGCCTCTAATCTAAAATGG - Intergenic
984008849 4:174346594-174346616 TATGAACCTTAAATGTAAAAGGG - Intergenic
985256215 4:188072425-188072447 TCAGAATCTCTATTAGAAAATGG - Intergenic
985620955 5:955289-955311 TCTGCACCTCATCTGGAAAATGG + Intergenic
986323864 5:6657078-6657100 TCTAAAACTTTAATGGAGAAAGG + Intronic
986746190 5:10747327-10747349 TCTGAACCTTTAAGGAAAATAGG + Intronic
986975689 5:13390632-13390654 TCTGAACCTAAAATGAAAATTGG + Intergenic
987551819 5:19392690-19392712 TCTGTCCCTCTAATGCAATACGG - Intergenic
990046009 5:51432590-51432612 TTTGCACCTCTCATAGAAAATGG - Intergenic
992569893 5:78044543-78044565 GCTGAAACTGTAATGTAAAAGGG + Intronic
996565325 5:124874221-124874243 TCTCTTCCTCTTATGGAAAAAGG - Intergenic
996900508 5:128537964-128537986 TGTGAACCTCAAAAGAAAAAAGG + Exonic
997636493 5:135410691-135410713 TCTGAGCCTATAATCGGAAAAGG - Intergenic
998657922 5:144203087-144203109 TCTTAACCTTTTTTGGAAAATGG - Intronic
998757834 5:145400078-145400100 TCTGGACCTTTATTGGATAATGG + Intergenic
998792561 5:145780869-145780891 TCTGAATTTCCAAAGGAAAATGG - Intronic
1000328430 5:160189039-160189061 TCTGACCCTTTATAGGAAAAGGG - Intronic
1002830374 6:815050-815072 TCTCAACCTAGACTGGAAAACGG - Intergenic
1003816947 6:9851797-9851819 TCTGCACCTGTCATGGAAAGAGG - Intronic
1004927192 6:20427341-20427363 TCTGAACTTCTAAGAGGAAAGGG - Intronic
1005392476 6:25347813-25347835 TGAGAACCTGAAATGGAAAAAGG - Intronic
1005471972 6:26170156-26170178 TCTGACCATCAAATGTAAAATGG + Intronic
1005696971 6:28360543-28360565 TATGAACCTCTGGTAGAAAATGG + Intronic
1005790526 6:29295653-29295675 TCTGAGCCTGCAATGGCAAAGGG - Intergenic
1006908437 6:37548420-37548442 TCTGAACCTATAGTAGAACAAGG - Intergenic
1007165500 6:39825943-39825965 TCTTAATTTCTAATGGGAAATGG + Intronic
1008461706 6:51782449-51782471 CCTGAACCTCTAAGGGGCAAAGG + Intronic
1008850795 6:56018737-56018759 TATGAATCTCTAAATGAAAACGG + Intergenic
1011527419 6:88280276-88280298 TCTGAACCTTAAAAGAAAAAGGG - Intergenic
1014408273 6:121080045-121080067 TCTGTACATGTAAAGGAAAATGG - Intronic
1014746581 6:125208059-125208081 TCTGAAACTATATTGAAAAAGGG - Intronic
1015595686 6:134864408-134864430 TCAGATCCTCAAATAGAAAAAGG + Intergenic
1015792146 6:136974327-136974349 CCTGACCCCCTAATGTAAAATGG + Intergenic
1016966677 6:149724546-149724568 TGTGAAACTGTATTGGAAAATGG + Exonic
1017637661 6:156458883-156458905 TCAGCAATTCTAATGGAAAATGG - Intergenic
1020993171 7:15228009-15228031 TCTGAACTTCTACTGGGACAGGG + Intronic
1021167546 7:17359734-17359756 TCTGAACCTCTCCTGGAAGGGGG + Intergenic
1023381343 7:39611381-39611403 CCTGAACCTCTAAAGGGAAAAGG + Intergenic
1026574302 7:71559501-71559523 TCTGAGCCTCAGTTGGAAAATGG + Intronic
1027618517 7:80453925-80453947 TCTGAAGCATTAATGGAAAGGGG + Intronic
1027716947 7:81684475-81684497 TCTCCACCTGCAATGGAAAATGG - Intergenic
1027848079 7:83410919-83410941 TCTGAATCTTTAATGTATAATGG + Intronic
1028219635 7:88182030-88182052 TCTGAACCTCTAATGGAAAAAGG + Intronic
1028713978 7:93942724-93942746 TCTGAACTTCTTATGAAAATTGG + Intergenic
1031197439 7:118633822-118633844 TCCCAACATCTAAGGGAAAAAGG + Intergenic
1033837402 7:145331960-145331982 TCTGAACCTGTGATCCAAAAAGG + Intergenic
1036470487 8:9048451-9048473 TCTGCAGCTCTGGTGGAAAATGG + Intronic
1036937203 8:13014705-13014727 TTTGAATCTTTAGTGGAAAAAGG + Intronic
1041174854 8:55185006-55185028 ACTGAACCTCAAATGGTATAAGG - Intronic
1041226356 8:55702555-55702577 TCTGAACCTCAATGGGAAATTGG + Intronic
1041620937 8:59968416-59968438 TCAAACCCTCTAGTGGAAAAGGG - Intergenic
1042590415 8:70392972-70392994 CCTGAACCTCAAAAGGAAATAGG + Intronic
1043779003 8:84307962-84307984 TCTTAACAGCTAATGGAAATAGG - Intronic
1044797217 8:95915898-95915920 TCTGAACCTTAATTTGAAAATGG - Intergenic
1046706613 8:117460515-117460537 TCTGTACATCTAATGAAAACAGG - Intergenic
1046758665 8:117997675-117997697 TCTGTACCTCTACTGAATAATGG - Intronic
1047338424 8:123957565-123957587 TCTGAACCTCTGTTATAAAATGG - Intronic
1048725253 8:137375899-137375921 TTTGATCCTATAATGCAAAATGG - Intergenic
1049134625 8:140884889-140884911 TCTGAATCTGTAATAGTAAATGG - Intronic
1050043150 9:1516445-1516467 TATGAACTTCTTATTGAAAAAGG + Intergenic
1050525576 9:6543551-6543573 TCTGAACCTCATTTAGAAAATGG - Intronic
1052422853 9:28266389-28266411 TGTGACCCTCTAATGGACAAAGG + Intronic
1052507613 9:29376316-29376338 TCTGCACCTCTTATGAGAAAAGG + Intergenic
1053464173 9:38292840-38292862 TCTCAACCATTATTGGAAAATGG + Intergenic
1055272645 9:74578523-74578545 TCTGAACCTAAAATTAAAAATGG + Intronic
1058957526 9:109962977-109962999 TCTGAACCTCACATATAAAATGG - Intronic
1059514765 9:114882861-114882883 ACTGAACCTCTAAAGGGAAAAGG + Intergenic
1061215099 9:129217182-129217204 TCTGAACCTCCTCTGTAAAATGG - Intergenic
1061477370 9:130877294-130877316 TCTTATCCTTTAATGGGAAATGG + Intronic
1185479769 X:437667-437689 TCAGATCTTCTAAAGGAAAACGG - Intergenic
1186443230 X:9604019-9604041 TCAGAACCTCATTTGGAAAAAGG - Intronic
1187110002 X:16288228-16288250 GCTGGACCTTGAATGGAAAAAGG - Intergenic
1188290352 X:28380003-28380025 TCTGAAACTATAGTGGAAACTGG + Intergenic
1188633951 X:32404946-32404968 TTTTTTCCTCTAATGGAAAATGG - Intronic
1190095877 X:47480528-47480550 TCAGAACCTGTAAAGGAAAAAGG + Intronic
1190159381 X:48019738-48019760 TCTGAGCCTAAAAAGGAAAAGGG + Intronic
1190175092 X:48141971-48141993 TCTGAGCCTAAAAAGGAAAAGGG + Intergenic
1191034581 X:56010613-56010635 TATTAACCTTTAATGGAAATTGG + Intergenic
1192089172 X:68134584-68134606 ACTGAACCTCTAAAGGGAAAAGG + Intronic
1192172425 X:68865284-68865306 CCTGATCCTCTCATGAAAAATGG - Intergenic
1193113529 X:77754329-77754351 TATGAACCTTAAATGTAAAAGGG - Intronic
1193771224 X:85589955-85589977 CCTGAACCTGAAATTGAAAATGG + Intergenic
1195760823 X:108244580-108244602 TCTGAATCTTCAATGGAAAAGGG + Intronic
1196873743 X:120137551-120137573 CCTGAAGCTCAAAAGGAAAAAGG + Intergenic
1197903361 X:131396761-131396783 TCTGAAGCTCTAAGGGAACTGGG + Intronic