ID: 1028219913

View in Genome Browser
Species Human (GRCh38)
Location 7:88185028-88185050
Sequence CTTTTTCTACGGTTTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028219911_1028219913 -3 Left 1028219911 7:88185008-88185030 CCTGATTATAGCTGCATGGGCTT 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1028219913 7:88185028-88185050 CTTTTTCTACGGTTTTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028219913 Original CRISPR CTTTTTCTACGGTTTTCCCC AGG Intronic
906999990 1:50842667-50842689 CTTTTCCTTCTGTTTTCACCTGG + Intronic
908414978 1:63904390-63904412 CTTTTCCTCAGGATTTCCCCAGG + Intronic
908811326 1:67984937-67984959 CTTTTCATAGGGTTTTCTCCTGG + Intergenic
909445947 1:75748701-75748723 CTTATTCTACACTTATCCCCTGG - Intronic
913428201 1:118758423-118758445 CCTTTTCTAGGTATTTCCCCAGG + Intergenic
914710860 1:150212581-150212603 ATTTTTCAACGGTTTCCCTCTGG + Intergenic
915821486 1:159029475-159029497 CTTTCTCCAGGGTGTTCCCCGGG + Intronic
919776032 1:201194459-201194481 CTTTATCCACTCTTTTCCCCAGG - Intronic
923518568 1:234718375-234718397 CTTTTTCCACACTTTTCCCCCGG - Intergenic
1063756108 10:9010551-9010573 CTTGTTCTACGCTTTTGCCAAGG + Intergenic
1065146174 10:22770682-22770704 CTCTTTCTACAGTTTTCCTAGGG - Intergenic
1068222902 10:54065281-54065303 CTTTTTCTAGAGTTTGCCCTTGG + Intronic
1068484576 10:57641178-57641200 CTTTTTCTACTGTTTTCTGATGG - Intergenic
1068562863 10:58535860-58535882 CTTTTTCCACCCTTTTCCCTTGG - Intronic
1069401066 10:68047444-68047466 CTTTTGCAAATGTTTTCCCCTGG - Intronic
1069584221 10:69586744-69586766 CATTTTCCAAGTTTTTCCCCCGG + Intergenic
1072326497 10:94304002-94304024 CTTTTTCTTTTTTTTTCCCCTGG - Intronic
1077801324 11:5541193-5541215 ATTTTTCTACCCTCTTCCCCAGG - Intronic
1079127222 11:17725763-17725785 ATATTTCTAGGGTTTCCCCCAGG - Intergenic
1084920517 11:72465694-72465716 CTTTTTCTATGGGTTTCTCCAGG + Intergenic
1092308795 12:7330430-7330452 CTTTTTCAATTGTTTTACCCAGG + Intergenic
1095290058 12:40468054-40468076 CTTTTTCTTCAATTTTCTCCTGG - Intronic
1096199698 12:49672831-49672853 CTGTTTTTTGGGTTTTCCCCAGG - Intronic
1098842539 12:75493648-75493670 ATTTGTCTTCGGTCTTCCCCTGG + Exonic
1102180570 12:110909576-110909598 CTTCTTCTTGGGTTTTCCTCTGG + Intergenic
1103603375 12:122068620-122068642 GATTTTCTCCTGTTTTCCCCTGG - Intergenic
1105460302 13:20579379-20579401 CTCTTTCCACCCTTTTCCCCAGG + Intronic
1106043484 13:26116251-26116273 ATTTTTCTTCTGTTTTCCCTGGG - Intergenic
1106751921 13:32781523-32781545 GTTTTTCTACTTTTTTCCACCGG + Intergenic
1112690173 13:101884314-101884336 TTTCTTACACGGTTTTCCCCAGG - Intronic
1112785575 13:102947795-102947817 CGTTGTCTACAGTTTTCCCCAGG - Intergenic
1117961784 14:61170511-61170533 TTTTTTCTACTGTTTTCTACTGG + Intergenic
1122113423 14:99516412-99516434 TTTTTTCCACGCTTGTCCCCAGG - Intronic
1127684918 15:61334286-61334308 CTGTTTTTACGGTATTTCCCTGG - Intergenic
1130249661 15:82290849-82290871 CTTTTTGTACTGTTTTCCCTAGG - Intergenic
1137657215 16:50170617-50170639 CTTTGTCTACTGACTTCCCCAGG - Intronic
1139755617 16:69140873-69140895 CTTTTTCTACCGTCTGCCACAGG + Intronic
1141077421 16:81020152-81020174 CTTTGTGTACTGTGTTCCCCAGG - Exonic
1149033498 17:52109372-52109394 CTATTGCTTTGGTTTTCCCCTGG - Intronic
1153257698 18:3188738-3188760 CTTTTCTTACTGTTTTCCTCAGG + Exonic
1155151925 18:23129861-23129883 CTTTTTCAACTTTTGTCCCCAGG - Intergenic
1156659315 18:39328020-39328042 CTTTTTCTTGTGTTTTCCTCTGG + Intergenic
1158879283 18:61761190-61761212 CTTTTTCTGCAGTTTTTCACAGG - Intergenic
1161548289 19:4895766-4895788 CCTTTTCTTGGCTTTTCCCCAGG + Intronic
931434120 2:62232333-62232355 ATTTTTCTGAGGTTTTCCCTGGG - Intergenic
933300018 2:80530830-80530852 CTTTTTCCATGCTTTTCCCCTGG - Intronic
933518398 2:83335748-83335770 CTTTTACTTGGGTTTTCCCAAGG + Intergenic
934027545 2:88013823-88013845 CTATGTCTACGGTTTCACCCTGG + Intergenic
1171485512 20:25482711-25482733 CATTTTCTACATTTCTCCCCAGG - Intronic
1172571796 20:35976279-35976301 CTTTTCCTGCTGTTTTCCCACGG - Intronic
1174005029 20:47403745-47403767 CTTTTTCTGCCATTTTCCACTGG + Intergenic
1175261864 20:57679781-57679803 TTTTTCCCAAGGTTTTCCCCTGG - Intronic
956107034 3:65830297-65830319 CCTTTTATAAGATTTTCCCCAGG - Intronic
959765897 3:110027728-110027750 CTTTATTTGTGGTTTTCCCCTGG + Intergenic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
961658098 3:128454227-128454249 CTTTCTCTATCTTTTTCCCCTGG - Intergenic
968493454 4:902847-902869 CTTTTTCAAAGATTTTCCACTGG - Intronic
970466051 4:16324116-16324138 CTTTGTTCAGGGTTTTCCCCTGG + Intergenic
971197833 4:24486348-24486370 CTCTTTCTTCCATTTTCCCCTGG + Intergenic
973308780 4:48683911-48683933 TTTTGTCTGTGGTTTTCCCCAGG + Intronic
977808191 4:101327980-101328002 CTTTTTCTTCTTTTTTTCCCTGG - Intronic
977972343 4:103227042-103227064 CGTTTGGTAGGGTTTTCCCCTGG - Intergenic
983920300 4:173336731-173336753 CATTTTCCCCGGTTTTCCACTGG - Intergenic
984936014 4:184889935-184889957 CTTTTTCTGCTGCTTTCTCCGGG + Intergenic
985078033 4:186237435-186237457 GTTTCTCTACTCTTTTCCCCTGG + Intronic
986039640 5:3979441-3979463 CTTTTTCTTATGTTTTCCTCTGG + Intergenic
986538084 5:8813654-8813676 TTTCTTCTACAGTCTTCCCCAGG + Intergenic
987054836 5:14181609-14181631 CTGTGTCTACGGTTGCCCCCAGG + Intronic
993110685 5:83653806-83653828 CTTTCTCTGGGGTTTCCCCCTGG + Intronic
995063734 5:107838402-107838424 CCTTTTCTAAGTTTCTCCCCAGG - Intergenic
1003067128 6:2913252-2913274 CTGGTTTTATGGTTTTCCCCAGG + Intergenic
1003135597 6:3432720-3432742 CTTTTCCTAAGATTTTCCCAGGG - Intronic
1003225886 6:4205154-4205176 CTTTTCCCACAGTTTTCCCATGG + Intergenic
1005768722 6:29042292-29042314 CTTTTTCTAAGGTTAGCCCTTGG - Intergenic
1006883234 6:37357422-37357444 GTTTTGGTACTGTTTTCCCCTGG + Intronic
1007186932 6:39979711-39979733 CTTTTTTTACGTTCTTTCCCAGG + Intergenic
1010136617 6:72561726-72561748 GTATTTCTCAGGTTTTCCCCAGG + Intergenic
1012622985 6:101371065-101371087 CTTTTTCTATTTTTTTTCCCAGG + Intergenic
1014832606 6:126120736-126120758 TGTTTTCTAAGCTTTTCCCCTGG + Intergenic
1018172012 6:161151049-161151071 CTTTTTTTGAGGTTTTCCTCTGG - Intronic
1019610283 7:1933256-1933278 CGTCTGCCACGGTTTTCCCCAGG + Intronic
1020544875 7:9514713-9514735 CTTTCTTGACAGTTTTCCCCAGG + Intergenic
1021830041 7:24597156-24597178 CCTTCTTTACGTTTTTCCCCAGG - Intronic
1023731851 7:43199102-43199124 CTCTCTCCACGGTTTTCTCCAGG + Intronic
1024042091 7:45563773-45563795 CTTTTTTTAGGATTTTCCTCAGG + Intergenic
1024769531 7:52703419-52703441 CTTTGTCTTTGGTTTTCCACAGG - Intergenic
1025783331 7:64621273-64621295 CTTTCTCTTGGGTTTTCTCCTGG - Intergenic
1027976476 7:85162695-85162717 CTTTTTCCACGTTCTTCCTCAGG - Intronic
1028219913 7:88185028-88185050 CTTTTTCTACGGTTTTCCCCAGG + Intronic
1031499948 7:122501654-122501676 CATTTTCTACGGTGTTAGCCAGG - Intronic
1034149767 7:148905701-148905723 CAATTTTTACGGTTTTCCCAGGG - Intergenic
1038928426 8:32166583-32166605 ATTTTTCTACCATTTTCACCTGG + Intronic
1039465789 8:37784253-37784275 CTTCCTCTACTGGTTTCCCCGGG + Intronic
1041461574 8:58117340-58117362 CTTTTTCTGCAGTTTTCTTCTGG - Intronic
1042595093 8:70438998-70439020 CTTTTTCTAAGGTTATCCTTAGG + Intergenic
1044901789 8:96954261-96954283 TTTTTTTTAAGGTTTTCCACAGG + Intronic
1045519918 8:102894658-102894680 CTCTTTCTGGGGTATTCCCCTGG - Intronic
1055311069 9:74980376-74980398 CATTTTTTACTGTTTTCCCCAGG + Intergenic
1055312090 9:74993306-74993328 CTTTCTCTTCTGTTTTCCCTTGG - Intronic
1056996088 9:91460669-91460691 ATTTTTCAAGGGTTTTCCCTGGG + Intergenic
1059094145 9:111394305-111394327 ATTTTTCTTTGCTTTTCCCCAGG - Exonic
1061449059 9:130659036-130659058 CTTTCCCTGCTGTTTTCCCCAGG + Intergenic
1186247384 X:7628687-7628709 ATATTTCTTCTGTTTTCCCCTGG - Intergenic
1190938807 X:55020509-55020531 CCTTTTCTCCTGTTTTCTCCTGG - Intronic
1193717301 X:84948055-84948077 AGTTTGGTACGGTTTTCCCCTGG - Intergenic
1194549199 X:95274609-95274631 CTTTTTCTAGTGTTATCCCAAGG - Intergenic
1199404301 X:147438372-147438394 CTGTTTCCTCGGTTTTCCCCAGG - Intergenic