ID: 1028229014

View in Genome Browser
Species Human (GRCh38)
Location 7:88283817-88283839
Sequence CAGGAGCACTGGATGCAAGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028229014_1028229023 25 Left 1028229014 7:88283817-88283839 CCGACTTGCATCCAGTGCTCCTG 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1028229023 7:88283865-88283887 GTTAAATGCTTTTACCACGTGGG 0: 1
1: 0
2: 1
3: 3
4: 119
1028229014_1028229017 -8 Left 1028229014 7:88283817-88283839 CCGACTTGCATCCAGTGCTCCTG 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1028229017 7:88283832-88283854 TGCTCCTGACTGGAGAGCCCAGG 0: 1
1: 1
2: 1
3: 31
4: 267
1028229014_1028229022 24 Left 1028229014 7:88283817-88283839 CCGACTTGCATCCAGTGCTCCTG 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1028229022 7:88283864-88283886 TGTTAAATGCTTTTACCACGTGG 0: 1
1: 0
2: 0
3: 11
4: 114
1028229014_1028229019 1 Left 1028229014 7:88283817-88283839 CCGACTTGCATCCAGTGCTCCTG 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1028229019 7:88283841-88283863 CTGGAGAGCCCAGGCTGAGATGG 0: 1
1: 0
2: 1
3: 44
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028229014 Original CRISPR CAGGAGCACTGGATGCAAGT CGG (reversed) Exonic
901189979 1:7403959-7403981 CAGGAGCACTCTAGGCAGGTAGG - Intronic
901254116 1:7806234-7806256 CAGCAGCACTGCAGGCAAGCAGG + Intronic
901401912 1:9020526-9020548 CAGGAGCCATTGCTGCAAGTTGG - Intronic
910909015 1:92214401-92214423 CTGGAACAGAGGATGCAAGTGGG + Intergenic
912385684 1:109270192-109270214 CAGGAGCAGGGGTTGCCAGTGGG - Intronic
912816617 1:112834045-112834067 CAAGAGCACTGCCTGCAAGAAGG + Intergenic
913532895 1:119745324-119745346 CAGGAGCACTTGGTGAATGTTGG + Intergenic
920044074 1:203122281-203122303 CAGGGGCACTGGATCCAGGCTGG - Intronic
920217290 1:204369879-204369901 CAGGAGGCCTCGCTGCAAGTTGG + Intronic
921778193 1:219127262-219127284 GAGGAGCACTGTGTGCAATTAGG - Intergenic
922098426 1:222462133-222462155 CAGGAGGAGAGGATGCACGTGGG + Intergenic
922992388 1:229925457-229925479 CAGGAGCTCTGGATGTATGCTGG + Intergenic
923215470 1:231844571-231844593 CAGGACAACTTGAAGCAAGTTGG + Intronic
924236653 1:242004700-242004722 CAGGAGCACTGCATGAGTGTTGG - Intergenic
924534190 1:244919937-244919959 CAGGAGCCCTGGCTGAAAGTGGG - Intergenic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1064448558 10:15420164-15420186 CAGCAGCTCAGGATGCAAGGTGG - Intergenic
1065425838 10:25602778-25602800 CTGGAGCACTGGAAGCTATTGGG + Intergenic
1066957776 10:42189179-42189201 CAGAAGCATTGCATGCAGGTAGG - Intergenic
1067170695 10:43903754-43903776 CGGGTGGACTGGATGCAATTCGG + Intergenic
1067443803 10:46327973-46327995 CAGGATCCCAGGATGCCAGTGGG - Intronic
1067718544 10:48708726-48708748 CAGGAGCAGTGTTTGCAAGTTGG - Intronic
1068008363 10:51417333-51417355 CAGGAATACTGGATTCCAGTGGG - Intronic
1069753469 10:70759823-70759845 CAGCTGCTCTGGATGGAAGTGGG - Intronic
1070533978 10:77361707-77361729 CAGGAGCACTGGCTCCAGTTGGG + Intronic
1070780382 10:79134174-79134196 CAGGAGCACCAGATGCCACTGGG + Intronic
1075301113 10:121324960-121324982 CAGGAGCACAGTATGTAAGCAGG + Intergenic
1075326863 10:121540082-121540104 AAGGATCACTGGATGAAGGTTGG + Intronic
1075558907 10:123454068-123454090 CAGGACCACTTGATGCCAGCAGG + Intergenic
1076146960 10:128130370-128130392 CAGGAGCATTGGGTACAAATAGG - Intergenic
1078067489 11:8087933-8087955 CAGGACCACAGGATGCAACCAGG - Intronic
1078906862 11:15695767-15695789 CAAGAGCACTGGATGCAATGAGG + Intergenic
1080136461 11:28860261-28860283 AAGGAGAAATGGATGCCAGTTGG + Intergenic
1080777616 11:35400979-35401001 CAGGACAACTGGAAGCAAGGAGG + Intronic
1083163887 11:60871840-60871862 CAGGTGCCCAGGATGCCAGTGGG + Intronic
1084135300 11:67174516-67174538 AAGCAACACTAGATGCAAGTAGG - Intronic
1084517689 11:69645377-69645399 CAGGACCCCTGGGTGCTAGTGGG + Intronic
1085201173 11:74703277-74703299 CAGGGGCACTGGGAGCAAGGAGG - Intronic
1088641217 11:111874840-111874862 AAGGACTACTGGTTGCAAGTTGG + Exonic
1089567415 11:119379014-119379036 CAGGGGCACTGGATGGGAGCTGG + Intronic
1089999049 11:122937940-122937962 CAGCAACACTGGATGCAAGAAGG - Intronic
1093969700 12:25363636-25363658 CAGCAGCACTGGCTTCATGTGGG - Intergenic
1096080511 12:48829369-48829391 CAGGAGCAATGGGTCCAACTAGG + Intergenic
1101855848 12:108442105-108442127 CTGGAGGACTGGCTGCCAGTGGG - Intergenic
1103126355 12:118426052-118426074 CAGGATCACTGGAAGCCATTTGG - Intergenic
1103680530 12:122690221-122690243 CAGGAGCACTGGGTGGCTGTGGG - Intergenic
1104230937 12:126883364-126883386 CAGGATCACTGCATGCATTTTGG + Intergenic
1104463831 12:128974813-128974835 TTTGAGCACTGGATGCATGTTGG + Intronic
1110884485 13:80616397-80616419 CAGGGGCACAGGTTGTAAGTGGG - Intergenic
1112144499 13:96682478-96682500 CAGGAGCTCTGGCTGTAAATTGG + Intronic
1112430068 13:99343255-99343277 CAGCAGCAGTTTATGCAAGTGGG + Intronic
1116655686 14:47650621-47650643 CAGCAGCCCAGGGTGCAAGTTGG - Intronic
1117754182 14:58957026-58957048 CAGGAGCAGTGGAGGCTATTGGG + Intergenic
1118720389 14:68589782-68589804 CAGCAGCCCTGAATGCAATTTGG + Intronic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1122258688 14:100499737-100499759 CAGGAGCTCTGGAAGGAAGGAGG - Intronic
1122972838 14:105159292-105159314 TAGGAGCACAGGATGGAAGTGGG + Intronic
1123129339 14:105973066-105973088 CAGGAACTCTGGATTCAAGGTGG - Intergenic
1202935330 14_KI270725v1_random:82597-82619 CAGAAGCATTGCATGCAGGTAGG + Intergenic
1123519184 15:21055940-21055962 CAGGAACTCTGGATTCAAGGTGG - Intergenic
1124577970 15:30926245-30926267 AAGGAACACTGAATGGAAGTGGG - Intronic
1127241488 15:57120256-57120278 AGGGAGCACTGAATCCAAGTTGG - Intronic
1128435365 15:67642612-67642634 CAGGAGCAAAGGCTGTAAGTAGG + Intronic
1128492794 15:68166916-68166938 CAGGAGCACTGCATGAACCTGGG - Intronic
1128644702 15:69367836-69367858 CAGGAGCTCTGGAAGTTAGTGGG + Intronic
1128649008 15:69396992-69397014 CAGGAGACCTGGGTTCAAGTAGG - Intronic
1130496762 15:84473594-84473616 AAGGAGCACTGGCTGCAGGGGGG - Intergenic
1130589796 15:85204545-85204567 AAGGAGCACTGGCTGCAGGGGGG + Intergenic
1130790925 15:87155566-87155588 CAGTAGCACTAAATGCAACTTGG - Intergenic
1131429785 15:92377546-92377568 GAGGAGCACTGGCTGCCAGCTGG + Intergenic
1131571607 15:93543046-93543068 CAGCAGCACTGGAAACAAGAGGG - Intergenic
1132403138 15:101526184-101526206 GAGGAGCACAGGCTGCAAGCTGG - Intergenic
1132602528 16:780059-780081 CAGGAGGGCTGGATGCCAGCGGG - Exonic
1133850665 16:9500373-9500395 GAGGAGCACTGGAGGCCAGTAGG - Intergenic
1136849000 16:33599127-33599149 CAGGAGCACTGGAAGTAATGGGG + Intergenic
1137726547 16:50660552-50660574 CTGGAGCACTGGCTGCACTTGGG - Intergenic
1139901247 16:70330130-70330152 CAGGAGGACTGGATGCCCCTGGG + Intronic
1141137933 16:81478712-81478734 CAAGAGAACTGAATTCAAGTGGG - Intronic
1141237998 16:82238144-82238166 CAGGTGCACTGGTTGCTACTGGG - Intergenic
1141629917 16:85281826-85281848 CAGGAGCTCTGGAAGCAAAGCGG + Intergenic
1142289161 16:89184860-89184882 CAGGAGCATTGGATGCGACCTGG - Intronic
1203110707 16_KI270728v1_random:1447777-1447799 CAGGAGCACTGGAAGTAATGGGG + Intergenic
1143250003 17:5516215-5516237 CAGGAGCACCGGGTCCATGTAGG + Intronic
1143542459 17:7577756-7577778 CAGGAACCCTGGCTTCAAGTAGG - Intronic
1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG + Intergenic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146546365 17:33742221-33742243 CTGGAGCACTGGAAACAAATGGG - Intronic
1146556089 17:33825358-33825380 TGGGAGCACTGGATGGAAGAGGG + Intronic
1146747370 17:35344279-35344301 TGGGAGCACAGGCTGCAAGTTGG + Intergenic
1149581758 17:57755644-57755666 CAGGGGCACTGCAGGCCAGTGGG - Intergenic
1151423706 17:74015946-74015968 CATGAGCCCTGGGTGCAAGGAGG + Intergenic
1152925255 17:83084714-83084736 CAGGTGCACTGGAAGGAACTGGG + Intronic
1154338979 18:13487893-13487915 CAGGAGCACTGAGAGCAAGGGGG + Intronic
1155400153 18:25429253-25429275 TTGGAGCACTGGATGCCAGTGGG + Intergenic
1157500346 18:48186125-48186147 CAGGCACACTGCATGCTAGTTGG + Intronic
1159001366 18:62978341-62978363 CAGGAGCACGGACTGCACGTGGG - Exonic
1159172642 18:64791390-64791412 CAGCAGCCCTAGATGCACGTTGG - Intergenic
1159176267 18:64838933-64838955 CAGGAGCAAGGGATGAATGTTGG + Intergenic
1162570057 19:11466414-11466436 CAGGAGCGATGGAGGCAGGTGGG - Intronic
1162690101 19:12422639-12422661 TAGAAGCACTGGATGGAGGTTGG + Intronic
1166654491 19:44600206-44600228 CAGGAACACAGGAGGCAAGGAGG + Intergenic
1167660958 19:50795765-50795787 TATGAGCACTGGAAGCAGGTAGG + Intergenic
927196704 2:20552773-20552795 CAGGAGCACTGGATTGAACTAGG - Intergenic
929031094 2:37650449-37650471 CAGCAGCACTTGATACAAGTCGG + Intronic
929410816 2:41696098-41696120 CTGGAGCACAGGGAGCAAGTCGG - Intergenic
930481012 2:51948159-51948181 CAGAAGCATTGCATGCTAGTTGG + Intergenic
934305895 2:91821696-91821718 CAGAAGCATTGCATGCAGGTAGG - Intergenic
934327361 2:92031046-92031068 CAGAAGCATTGCATGCAGGTAGG + Intergenic
934465746 2:94261626-94261648 CAGAAGCATTGCATGCAGGTGGG + Intergenic
934646831 2:96063806-96063828 AAGGAGCACCGGAAGCAAGCAGG - Intergenic
934840231 2:97619888-97619910 AAGGAGCACCGGAAGCAAGCAGG - Intergenic
935211754 2:100944773-100944795 GACGAACGCTGGATGCAAGTAGG - Intronic
935818218 2:106867724-106867746 AATGAGCACTGGTTGTAAGTAGG + Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936411780 2:112265240-112265262 TAGGTACATTGGATGCAAGTGGG + Intergenic
936573222 2:113633564-113633586 CAGGAGCACTTGGTACAAGGTGG - Intronic
937152467 2:119695467-119695489 CAGGTGCCCAGGATGCAAGAAGG - Intergenic
937523357 2:122737971-122737993 CAGCATCACTGGACGCAAGAAGG + Intergenic
937638478 2:124184807-124184829 CAGGAGCACTGGACCTAAGATGG + Intronic
938186923 2:129240104-129240126 CAGAAGCTCTGGCTCCAAGTTGG + Intergenic
940149799 2:150587215-150587237 CAGGAGCCCTGGGTTCAAATTGG + Intergenic
940893547 2:159058241-159058263 CAGAAGCACTGGCTGCAGGTAGG - Intronic
942614377 2:177775062-177775084 CACGAGCACAGAATGCAGGTAGG + Intronic
944593024 2:201236162-201236184 CAGGAGGACAGGATTCAAGAGGG - Intronic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945815176 2:214596821-214596843 CAGGGACACTGGAGGCAAATGGG - Intergenic
946007163 2:216535353-216535375 CAGGGGCACTTGAAGCCAGTGGG - Intronic
946334847 2:219029792-219029814 CAGCATCACTGGATGCCAGTGGG + Intronic
948900814 2:240956102-240956124 CAGGAGCCCTGGAGGCACCTGGG - Intronic
1168939852 20:1699980-1700002 CAGAAGCACTGGAAGCCAGAAGG + Intergenic
1170739443 20:19042075-19042097 GAGGAGCACTGGAGGAAATTGGG + Intergenic
1170775414 20:19371108-19371130 CAGGAGCTCTGGGGGCAACTGGG + Intronic
1171032913 20:21693039-21693061 CTGGGTCACAGGATGCAAGTGGG + Intergenic
1173953638 20:47013260-47013282 CAGGAGAACTGCATGCTACTCGG + Intronic
1175597127 20:60244200-60244222 CAGGTGCACTGGATGGAGGATGG + Intergenic
1175648912 20:60699653-60699675 CAGGATCACTGGATGGCAGAGGG - Intergenic
1176191870 20:63815243-63815265 CAGGTGCAGTGGGTGCAGGTGGG + Intronic
1176191936 20:63815587-63815609 CAGGTGCAGTGGGTGCAGGTGGG + Intronic
1176596751 21:8704833-8704855 CAGAAGCATTGCATGCAGGTAGG + Intergenic
1178494071 21:33071949-33071971 CGGGAACACTGGATGCAAGGCGG - Exonic
1178820007 21:35966423-35966445 CTGGAGCACTTGATGCATTTTGG - Intronic
1179818197 21:43921475-43921497 CAGGAGCACAGGTCACAAGTGGG + Intronic
1180279670 22:10682275-10682297 CAGAAGCATTGCATGCAGGTAGG + Intergenic
1180586885 22:16900805-16900827 CAGAAGCATTGCATGCAGGTAGG + Intergenic
1182120637 22:27784179-27784201 CAGGAGCAGGGGATGCACCTAGG + Intronic
1182434211 22:30319986-30320008 GAGGAGCACTGGGTGACAGTCGG + Intronic
1184113734 22:42410001-42410023 AAGGAGGACTGGATGCCAGCAGG - Intronic
1185426963 22:50777316-50777338 CAGGAGCACTTGGTACAAGGTGG + Intronic
949509605 3:4756787-4756809 AATTATCACTGGATGCAAGTTGG + Intronic
949509959 3:4759075-4759097 AATTATCACTGGATGCAAGTTGG - Intronic
950704167 3:14769755-14769777 TAGGGGCACTGGATGGAAGAGGG + Intronic
952947318 3:38487019-38487041 CAGGGGCAAGGGCTGCAAGTGGG + Exonic
952963684 3:38608264-38608286 CCAGAGCCCTGGATGCAAGGCGG - Intronic
955272934 3:57519938-57519960 CAGGAGCGCAGGCTCCAAGTCGG - Intronic
956505077 3:69929299-69929321 CAGGAGCACTGGTAGCATGTGGG + Intronic
956650668 3:71501740-71501762 GAGGAGCAATGGATTCAAGGTGG - Intronic
956785783 3:72641122-72641144 CGGGAGCAGTAGATGGAAGTAGG + Intergenic
958761645 3:98316352-98316374 CAGGAGAACAGGGTGAAAGTGGG + Intergenic
958806714 3:98819774-98819796 AAGGAGGACTGGATTGAAGTTGG - Intronic
960907960 3:122620668-122620690 CAGGAGCAGAGGATGAAGGTGGG + Intronic
961356252 3:126341788-126341810 TATAAGAACTGGATGCAAGTCGG - Intergenic
962295858 3:134185673-134185695 CAGGACTACTGGAGGCTAGTAGG + Intronic
964703473 3:159593884-159593906 CAGGAGCTCTGGATGCAGCCAGG - Intronic
965628108 3:170702617-170702639 CAAGAGCGCTGGATGCAAGAAGG - Intronic
966226133 3:177599904-177599926 CAGGAGCACTGCCTGCCAGGAGG - Intergenic
966612779 3:181884482-181884504 CAGGAGCTCAGGGTGCAAGGTGG + Intergenic
967388392 3:188931571-188931593 AAAGAACAGTGGATGCAAGTAGG - Intergenic
968604246 4:1524302-1524324 CAGAAGCACTGGGAGCACGTAGG + Intergenic
968604261 4:1524395-1524417 CAGAAGCACTGGGAGCACGTAGG + Intergenic
968604277 4:1524488-1524510 CAGAAGCACTGGGAGCACGTAGG + Intergenic
969506664 4:7592219-7592241 CAGCAGCTGTGGATGAAAGTGGG - Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
972668935 4:41195465-41195487 GTGGAGAACTGGATGCAGGTAGG - Intronic
972809481 4:42566426-42566448 CTGGAGCACAGGATTCAACTGGG + Intronic
975342065 4:73253852-73253874 CAGAAGCCCTGGATCCAAGAAGG + Intronic
975602447 4:76116592-76116614 CAGGAGATCTGGATGGAGGTAGG - Intronic
975696991 4:77023207-77023229 CAGGGGAAATGGATCCAAGTGGG - Intronic
978263778 4:106796694-106796716 CTGGATCACAGGATACAAGTGGG + Intergenic
984753529 4:183302297-183302319 CTGAAGCAGTGGATGCACGTGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
987091104 5:14508264-14508286 CAGGAGCAGTGGCTGCAGGCCGG + Exonic
991303782 5:65154542-65154564 CAGGAGATCTGGATTCAGGTGGG + Intronic
991977048 5:72193756-72193778 CAGGATCACAGGATGCACATAGG - Intronic
994747737 5:103700019-103700041 CAGGAGCAATGGCTGCATGACGG - Intergenic
999292041 5:150432187-150432209 CTGAAGCACAGGATGCTAGTAGG - Intergenic
1003528673 6:6919870-6919892 CAGAAGCACTGGGTGGAAGTAGG - Intergenic
1006650826 6:35549908-35549930 CAGGGGCTCTGGGTGCATGTTGG - Intergenic
1007940301 6:45774337-45774359 CGGGAGACCTGGTTGCAAGTGGG + Intergenic
1015217566 6:130767696-130767718 CAGCAGCAATGGATGCAAAAGGG - Intergenic
1017557459 6:155587416-155587438 TAAAGGCACTGGATGCAAGTAGG - Intergenic
1018737136 6:166695750-166695772 CAGGAGCACTGGATTCTCATAGG + Intronic
1018737140 6:166695788-166695810 CAGGAGCACTGGATTCTCATAGG + Intronic
1018737146 6:166695845-166695867 CAGGAGCACTGGATTCTCATAGG + Intronic
1019262298 7:88369-88391 CAGGAACACTGGCTGAACGTGGG - Intergenic
1019658670 7:2211437-2211459 CTGGAGCACTGGGTGTCAGTCGG - Intronic
1023095724 7:36657660-36657682 CAGCAGCACTGAATGCTAGCTGG + Intronic
1028229014 7:88283817-88283839 CAGGAGCACTGGATGCAAGTCGG - Exonic
1029924474 7:104301159-104301181 CAGGAGCAATGGATGGAACATGG + Intergenic
1030901743 7:115132878-115132900 ATGGAGCACTTGATCCAAGTAGG - Intergenic
1032497941 7:132376822-132376844 AAGGAGGACTGGGTGCAGGTGGG - Intronic
1033601453 7:142891971-142891993 CAGGAGGACTGAATGCCTGTGGG - Intergenic
1034461693 7:151201085-151201107 CAGGATCACTGAGTGCTAGTGGG + Intronic
1035786869 8:2268438-2268460 AAGGAGCAGTGGATGGAAGCAGG - Intergenic
1035805938 8:2453278-2453300 AAGGAGCAGTGGATGGAAGCAGG + Intergenic
1038122667 8:24635465-24635487 CAGGAGCACTGCATGCAGAGAGG + Intergenic
1044627896 8:94252183-94252205 CATGACCACTGCATGCAGGTCGG - Exonic
1047432950 8:124808488-124808510 CAGGAGCACTGGAGGCCGATGGG - Intergenic
1049403965 8:142443401-142443423 CTGCAGCACTGGAGGCAGGTGGG + Intergenic
1050403158 9:5278646-5278668 CAGGTGGATTGGTTGCAAGTAGG - Intergenic
1053695807 9:40638406-40638428 CAGAAGCATTGCATGCAGGTAGG + Intergenic
1053942795 9:43269443-43269465 CAGAAGCATTGCATGCAGGTAGG + Intergenic
1054307054 9:63437624-63437646 CAGAAGCATTGCATGCAGGTAGG + Intergenic
1054439412 9:65247099-65247121 CAGAAGCATTGCATGCAGGTAGG + Intergenic
1054490995 9:65774840-65774862 CAGAAGCATTGCATGCAGGTAGG - Intergenic
1059532249 9:115046312-115046334 CAGGAGCTTTGGATGCAGGCAGG - Intronic
1062362934 9:136196053-136196075 CATGAGCACTGGAAGGAGGTGGG - Intergenic
1202778252 9_KI270717v1_random:12018-12040 CAGAAGCATTGCATGCAGGTAGG + Intergenic
1187014760 X:15315688-15315710 CAGGAGCACTGAGTGCTAGAAGG - Intergenic
1187341263 X:18424033-18424055 CAGGAGTTCTGGATCCACGTGGG + Intergenic
1187542779 X:20214466-20214488 CAGCAGAACTGGATGCTAGAAGG - Intronic
1188339274 X:28978632-28978654 CATGAACACTAGATTCAAGTTGG - Intronic
1190863448 X:54364609-54364631 TAGCAGCAATGGATGCATGTAGG - Intergenic
1194350761 X:92823144-92823166 CAGGAGAACTTGAGGCAGGTTGG + Intergenic
1196011079 X:110888655-110888677 CAGGATCACTGAATGGAAGCTGG - Intergenic
1198805586 X:140491093-140491115 CTGGAGCCCTGGAGGCCAGTGGG + Intergenic
1198992203 X:142527454-142527476 CAGGAGCTTTTGATCCAAGTGGG + Intergenic
1199107812 X:143891865-143891887 CAGAAGCACTGGATTCAAATTGG + Intergenic
1200659088 Y:5939824-5939846 CAGGAGAACTTGAGGCAGGTTGG + Intergenic
1201644561 Y:16215607-16215629 CATGAACACTGTATGCAATTGGG - Intergenic
1201658254 Y:16369714-16369736 CATGAACACTGTATGCAATTGGG + Intergenic