ID: 1028237032

View in Genome Browser
Species Human (GRCh38)
Location 7:88374487-88374509
Sequence AGAGAGACTGGAACAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028237032_1028237038 12 Left 1028237032 7:88374487-88374509 CCAGCATCTGTTCCAGTCTCTCT No data
Right 1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG No data
1028237032_1028237034 4 Left 1028237032 7:88374487-88374509 CCAGCATCTGTTCCAGTCTCTCT No data
Right 1028237034 7:88374514-88374536 TGTGCCTTCCTGTACTGCAGAGG No data
1028237032_1028237036 8 Left 1028237032 7:88374487-88374509 CCAGCATCTGTTCCAGTCTCTCT No data
Right 1028237036 7:88374518-88374540 CCTTCCTGTACTGCAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028237032 Original CRISPR AGAGAGACTGGAACAGATGC TGG (reversed) Intergenic
No off target data available for this crispr