ID: 1028237033

View in Genome Browser
Species Human (GRCh38)
Location 7:88374499-88374521
Sequence AAGGCACACTACAGAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028237033_1028237038 0 Left 1028237033 7:88374499-88374521 CCAGTCTCTCTGTAGTGTGCCTT No data
Right 1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG No data
1028237033_1028237036 -4 Left 1028237033 7:88374499-88374521 CCAGTCTCTCTGTAGTGTGCCTT No data
Right 1028237036 7:88374518-88374540 CCTTCCTGTACTGCAGAGGCTGG No data
1028237033_1028237034 -8 Left 1028237033 7:88374499-88374521 CCAGTCTCTCTGTAGTGTGCCTT No data
Right 1028237034 7:88374514-88374536 TGTGCCTTCCTGTACTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028237033 Original CRISPR AAGGCACACTACAGAGAGAC TGG (reversed) Intergenic
No off target data available for this crispr