ID: 1028237034

View in Genome Browser
Species Human (GRCh38)
Location 7:88374514-88374536
Sequence TGTGCCTTCCTGTACTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028237032_1028237034 4 Left 1028237032 7:88374487-88374509 CCAGCATCTGTTCCAGTCTCTCT No data
Right 1028237034 7:88374514-88374536 TGTGCCTTCCTGTACTGCAGAGG No data
1028237033_1028237034 -8 Left 1028237033 7:88374499-88374521 CCAGTCTCTCTGTAGTGTGCCTT No data
Right 1028237034 7:88374514-88374536 TGTGCCTTCCTGTACTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028237034 Original CRISPR TGTGCCTTCCTGTACTGCAG AGG Intergenic
No off target data available for this crispr