ID: 1028243235

View in Genome Browser
Species Human (GRCh38)
Location 7:88446509-88446531
Sequence TGCTCCGTATGTTGCATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028243233_1028243235 18 Left 1028243233 7:88446468-88446490 CCTGCAAAAAGTCAGAGCTGGTA No data
Right 1028243235 7:88446509-88446531 TGCTCCGTATGTTGCATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028243235 Original CRISPR TGCTCCGTATGTTGCATCAA AGG Intergenic
No off target data available for this crispr