ID: 1028248258

View in Genome Browser
Species Human (GRCh38)
Location 7:88508995-88509017
Sequence AAGGCCAAGCAGGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028248258_1028248270 22 Left 1028248258 7:88508995-88509017 CCTTCCTCATCCTGCTTGGCCTT No data
Right 1028248270 7:88509040-88509062 CCACATCTCCTTCTCTTGCCGGG No data
1028248258_1028248271 23 Left 1028248258 7:88508995-88509017 CCTTCCTCATCCTGCTTGGCCTT No data
Right 1028248271 7:88509041-88509063 CACATCTCCTTCTCTTGCCGGGG No data
1028248258_1028248266 -3 Left 1028248258 7:88508995-88509017 CCTTCCTCATCCTGCTTGGCCTT No data
Right 1028248266 7:88509015-88509037 CTTGGAGGGACAGTCAATGGAGG No data
1028248258_1028248264 -6 Left 1028248258 7:88508995-88509017 CCTTCCTCATCCTGCTTGGCCTT No data
Right 1028248264 7:88509012-88509034 GGCCTTGGAGGGACAGTCAATGG No data
1028248258_1028248268 21 Left 1028248258 7:88508995-88509017 CCTTCCTCATCCTGCTTGGCCTT No data
Right 1028248268 7:88509039-88509061 CCCACATCTCCTTCTCTTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028248258 Original CRISPR AAGGCCAAGCAGGATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr