ID: 1028265060

View in Genome Browser
Species Human (GRCh38)
Location 7:88713558-88713580
Sequence AGGTTGTTACATTGGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028265060_1028265070 25 Left 1028265060 7:88713558-88713580 CCCTACTCCCAATGTAACAACCT No data
Right 1028265070 7:88713606-88713628 ATGACCTGGTTTTAATGGTTAGG No data
1028265060_1028265067 11 Left 1028265060 7:88713558-88713580 CCCTACTCCCAATGTAACAACCT No data
Right 1028265067 7:88713592-88713614 GACCAAGAAAGAATATGACCTGG No data
1028265060_1028265069 20 Left 1028265060 7:88713558-88713580 CCCTACTCCCAATGTAACAACCT No data
Right 1028265069 7:88713601-88713623 AGAATATGACCTGGTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028265060 Original CRISPR AGGTTGTTACATTGGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr