ID: 1028270825

View in Genome Browser
Species Human (GRCh38)
Location 7:88786885-88786907
Sequence CTAAATATACAAATGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1850
Summary {0: 1, 1: 1, 2: 20, 3: 168, 4: 1660}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028270824_1028270825 -5 Left 1028270824 7:88786867-88786889 CCTTTTTGTGATAAGACACTAAA 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG 0: 1
1: 1
2: 20
3: 168
4: 1660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028270825 Original CRISPR CTAAATATACAAATGAAAAA AGG Intronic
901548900 1:9980455-9980477 CTAAAAATACAAAAAAAAATTGG + Intronic
901601768 1:10428308-10428330 CTAAAAAAAATAATGAAAAAAGG - Intergenic
901741819 1:11346774-11346796 CTAAATAAATAAATAAATAAAGG - Intergenic
902327499 1:15711302-15711324 CTAAAACTATAAAAGAAAAAAGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902829218 1:18999104-18999126 CTAAAAATACAAAAAAAAATTGG + Intergenic
903065603 1:20697617-20697639 GTAAATAAATAAATGAATAAAGG + Intronic
903584582 1:24401846-24401868 CTAAAAATACAAATTACAGATGG - Intronic
903735883 1:25529794-25529816 CTCCATCTACAAATGAAGAAAGG - Intergenic
904150241 1:28432640-28432662 AAAAAAATAAAAATGAAAAAAGG + Intronic
904221620 1:28975091-28975113 CTAAAAATACAAAAAAAAATTGG - Intronic
904271602 1:29353932-29353954 ATAAATAAAAAAATAAAAAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904390499 1:30182470-30182492 ATCAATATACAAAGCAAAAAGGG - Intergenic
904638473 1:31903113-31903135 CTAAATAAATAAATAAATAAAGG + Intergenic
904820489 1:33240024-33240046 CTAAATATAGAAATGAGAGTTGG + Intergenic
904949142 1:34222088-34222110 CTATAAATTCAAATTAAAAAAGG + Intergenic
904985872 1:34548249-34548271 CTGAATATAAAATTGTAAAATGG - Intergenic
905130822 1:35755705-35755727 CTAAAAAGACAAATGAAAAGTGG - Intronic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905540892 1:38759679-38759701 CTAAAGATACAAATGGTAATGGG + Intergenic
905673618 1:39809540-39809562 ATAAAAATAAAAATAAAAAAAGG - Intergenic
905705860 1:40057041-40057063 CTATAAATACAAATGAAATATGG + Intronic
905718891 1:40178831-40178853 CAAAAAATAAAAATAAAAAATGG - Intronic
906016432 1:42585236-42585258 TTAAATATCAAAATGAAAGAAGG - Intronic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
906390066 1:45407456-45407478 ATAACTAAGCAAATGAAAAAAGG - Intronic
907015401 1:51007228-51007250 CTAAATATAGAAAGGAAAAATGG + Intergenic
907228002 1:52967499-52967521 CAAAATAAACAAATGACAAGAGG - Intronic
907589719 1:55654658-55654680 ATAAATAAATAAATGGAAAAGGG + Intergenic
908158675 1:61384483-61384505 CATAATACACAAATGAAAGAAGG - Intronic
908238205 1:62167624-62167646 GAAAACAAACAAATGAAAAAAGG + Intergenic
908289709 1:62652076-62652098 CTAAATAAATAAATAAATAAAGG + Intronic
908577782 1:65479160-65479182 GTAATTTTACAAATGGAAAAAGG + Intronic
908861013 1:68489776-68489798 CACAATATACTAAAGAAAAAAGG - Intronic
908962773 1:69720241-69720263 ATAAATTAACAAATTAAAAATGG - Intronic
908993329 1:70121755-70121777 GTAAATACACAAATAAAACAGGG - Intronic
909026017 1:70482931-70482953 ATAAATAAATAAATAAAAAAAGG + Intergenic
909318247 1:74250648-74250670 TTAAAGAGAAAAATGAAAAAAGG - Intronic
909386397 1:75062101-75062123 CTAATAATCCAAATAAAAAATGG - Intergenic
909521494 1:76573702-76573724 TTAAAAATAAATATGAAAAATGG + Intronic
910118561 1:83759529-83759551 GTAAATACAAAAATGAAAAAAGG - Intergenic
910274662 1:85436153-85436175 CTAAAAATAAAGGTGAAAAAAGG + Intronic
910576419 1:88769954-88769976 ATAAACATACACATGAAAAGGGG + Intronic
910922014 1:92358498-92358520 TTAAATATAAAACTGAAAACAGG - Intronic
911111501 1:94192483-94192505 ATAAATATACAAAAGAAACCAGG - Intronic
911153903 1:94621133-94621155 TTAAATATATAAATGAATAAAGG - Intergenic
911226357 1:95309724-95309746 CTAAAAATAAAAATGAGGAAAGG - Intergenic
911328777 1:96501197-96501219 ATAAATAAATAAATGAAGAAAGG - Intergenic
911806428 1:102214240-102214262 CTATATAAAAAAATGAATAAGGG + Intergenic
911903812 1:103539570-103539592 CTAAGTAAACAAACAAAAAAGGG - Intronic
911952265 1:104189655-104189677 ATAAATAAATAAATGAATAAAGG - Intergenic
911991921 1:104709131-104709153 CTTAATATATAAATGAAATGTGG + Intergenic
912120392 1:106464559-106464581 CTAAAAATACAAAAAAAAATTGG - Intergenic
912145114 1:106784089-106784111 CTTAAGATAGTAATGAAAAAAGG + Intergenic
912245282 1:107955644-107955666 ACAAGTAGACAAATGAAAAAGGG + Intronic
912453427 1:109782206-109782228 CTAATTTGACAGATGAAAAATGG + Intergenic
912920419 1:113861538-113861560 CTAAAAATACAAAAAAAAATTGG - Intronic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
912960785 1:114193822-114193844 CTAATTATCCAATTAAAAAATGG - Intergenic
913965396 1:143373039-143373061 CTCACTTTACAAATGAGAAAAGG - Intergenic
914059771 1:144198641-144198663 CTCACTTTACAAATGAGAAAAGG - Intergenic
914119379 1:144767730-144767752 CTCACTTTACAAATGAGAAAAGG + Intergenic
914392464 1:147234812-147234834 GAAACTATACAAATGAAATAAGG - Intronic
914723526 1:150308668-150308690 CTAAAAATACAAAAAAAAATTGG + Exonic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914869875 1:151464105-151464127 CAAAACATACAAAAGAAAATTGG + Intergenic
915291076 1:154883812-154883834 AAAAAAATAAAAATGAAAAAGGG + Intergenic
915844731 1:159251874-159251896 CTAAAAATACAAAAAAAAATTGG - Intergenic
916229054 1:162521105-162521127 TTAAAAATTCAAATGAAGAATGG - Intronic
916309272 1:163376510-163376532 CTAGATATAGAATAGAAAAATGG - Intergenic
916593245 1:166214072-166214094 CTCAATAAAAAAATGATAAAGGG - Intergenic
916668760 1:166992041-166992063 ATAAAGATACAAATGAATTATGG + Intronic
916935671 1:169625654-169625676 ATAAATATATGAATGAATAATGG + Intronic
917017731 1:170552768-170552790 ATAAATATAGAAAAGTAAAATGG + Exonic
917422266 1:174876831-174876853 CAAAACATAAAAATGAAACAGGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918025630 1:180741989-180742011 CCAAAAATAAAAATGAAATAGGG - Intronic
918205939 1:182309560-182309582 CTCAATATACTGATCAAAAAGGG - Intergenic
918612472 1:186508694-186508716 CAACATATACAAATCAATAAAGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918666456 1:187156831-187156853 CTAAAATCAGAAATGAAAAAGGG - Intergenic
918798793 1:188943127-188943149 ATAAATATACATATGTAAATAGG - Intergenic
918806325 1:189050777-189050799 CTAAATTATCAAAGGAAAAAAGG - Intergenic
918834068 1:189436887-189436909 CTGAAAATAAAAATAAAAAATGG - Intergenic
918879796 1:190102592-190102614 CTAAATAAAAGAAGGAAAAAAGG + Intronic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919248183 1:195015571-195015593 CTCAACACACAAATTAAAAATGG - Intergenic
919363706 1:196629512-196629534 ATTAAAATAAAAATGAAAAATGG + Intergenic
919456506 1:197826787-197826809 CTATATATTAAAATGAAATAGGG + Intergenic
919518692 1:198559798-198559820 CTAAAGATACAATTCAGAAATGG + Intergenic
919541778 1:198855926-198855948 CTAAAGAGACAAATGAACAGTGG - Intergenic
919550404 1:198978414-198978436 CATAAGAAACAAATGAAAAAGGG + Intergenic
919565139 1:199174989-199175011 CCAAAAATACAAGTGAAAAAAGG + Intergenic
919711257 1:200731623-200731645 CTAATTTTATACATGAAAAATGG - Intergenic
920758357 1:208757333-208757355 CTAAATATACAAACTTCAAATGG + Intergenic
920824458 1:209412470-209412492 CTAAATTAAGAAATGAAGAAAGG - Intergenic
920923300 1:210316704-210316726 TTAAATATACTAATTAAAAATGG + Intergenic
921088615 1:211820645-211820667 AGAAACAAACAAATGAAAAACGG + Intronic
921374220 1:214457246-214457268 ATAAATTTGCAAAAGAAAAAGGG + Intronic
921410309 1:214829281-214829303 CTGATTATACAACTTAAAAATGG - Intergenic
921497280 1:215857189-215857211 GTAAATAAACAAATTAAAAAGGG + Intronic
921582091 1:216906828-216906850 CTAAATGTACAAAAATAAAAAGG - Intronic
921747833 1:218757895-218757917 TAAAATAAATAAATGAAAAATGG - Intergenic
921780176 1:219153606-219153628 CTAAAAATAAAAGCGAAAAAAGG + Intergenic
921975864 1:221202430-221202452 CTAAAAATACAAAGGTATAAAGG - Intergenic
921976657 1:221210156-221210178 CTAAATGTCCACAGGAAAAAGGG + Intergenic
922014645 1:221633103-221633125 ACAAACAAACAAATGAAAAAAGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922374455 1:224946770-224946792 CCAAATATACAAACAAAACAAGG - Intronic
922607455 1:226898951-226898973 CAAAAAATCCAAGTGAAAAATGG - Exonic
923164131 1:231343057-231343079 CTAAATATAAAGAAGAAAAAAGG - Intronic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
923741814 1:236661647-236661669 GTAAATATGCATATGAAAAGAGG + Intergenic
923754884 1:236783131-236783153 CTAAAAATACAAAAAAAAACTGG + Intergenic
923821745 1:237450925-237450947 ATAAATATAGAAAAGAAACAAGG - Intronic
923894623 1:238255731-238255753 CAAAATATATGAAAGAAAAAAGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924495034 1:244579664-244579686 AAAAATATACAAATGACCAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062852175 10:753054-753076 CTAAGTACACCAATGAAAAGAGG + Intergenic
1063239330 10:4152126-4152148 CAAAATATACAAATCCAACATGG - Intergenic
1063470425 10:6280267-6280289 CTACATATCCAAATAAAATAAGG - Intergenic
1063783807 10:9357068-9357090 ATAAATAAATAAATAAAAAAGGG - Intergenic
1063791348 10:9451705-9451727 TGAAATATAGAAATGAAAAGAGG - Intergenic
1063818204 10:9801801-9801823 CTAGATATGCAAAAGATAAAGGG - Intergenic
1064276084 10:13906247-13906269 CTATATAGACAGATAAAAAAAGG - Intronic
1064403605 10:15041259-15041281 ATAAAAATAAAAATAAAAAAAGG - Intronic
1064497492 10:15928107-15928129 TAAAATATGCAAATGAATAAAGG - Intergenic
1064660203 10:17600316-17600338 CTAAATAAATAAATAAATAAAGG - Intronic
1064727318 10:18294010-18294032 ATAAATATCCAAATGGAAACTGG - Intronic
1065281088 10:24139228-24139250 CCAAATATATATATTAAAAATGG - Intronic
1065515725 10:26522710-26522732 TTAAATATAAAAAGCAAAAATGG + Intronic
1065582755 10:27188096-27188118 CAAAATGTACAAATTTAAAATGG + Intergenic
1065756054 10:28932180-28932202 CTCAATAAAAAAATAAAAAAAGG + Intergenic
1066015351 10:31236805-31236827 CAAAATATGCAAATCAATAAAGG + Intergenic
1066469884 10:35688110-35688132 ATAAATATAAAAATAAAAATTGG - Intergenic
1066550623 10:36552682-36552704 CTAAATAAATAAATAAAAACAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066933853 10:41802017-41802039 CTAAACATAGAAAGGACAAACGG - Intergenic
1067396812 10:45927975-45927997 ATAAAGATAAAACTGAAAAAGGG - Intergenic
1067664419 10:48263461-48263483 CTAAAATCACAAATGAAATAAGG + Intronic
1067760815 10:49045340-49045362 AACAATAAACAAATGAAAAAAGG + Intronic
1067865132 10:49897068-49897090 ATAAAGATAAAACTGAAAAAGGG - Intronic
1067909392 10:50330487-50330509 ATAAATAAATAAATGAAAAGGGG + Intronic
1067957379 10:50807228-50807250 CCAAATTTATAAATGAGAAAAGG + Intronic
1068051567 10:51956516-51956538 CTAAATATCCAAAAGATTAATGG - Intronic
1068111016 10:52681092-52681114 CTAAATAAATAAAAGAAAACAGG + Intergenic
1068640292 10:59397628-59397650 CTAAATAAAAAAATTAAAATTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069234747 10:66056815-66056837 TTAAATGTATAAATGAACAATGG + Intronic
1069244043 10:66179689-66179711 TTAAAAATTTAAATGAAAAATGG - Intronic
1069337397 10:67368628-67368650 CTAAATAAATAAACGAATAATGG + Intronic
1069357579 10:67605176-67605198 CTATATATACAAAGGAAAAAAGG + Intronic
1069508155 10:69020107-69020129 CTAAAAATACAAAAAAAAATTGG + Intergenic
1069751492 10:70748095-70748117 CTAAACATACGCATGAAAAGTGG - Intronic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1069946701 10:71991313-71991335 CTAATTAAATATATGAAAAATGG + Intronic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071074202 10:81731863-81731885 CAAAAAATAAAAATAAAAAAGGG + Intergenic
1071103508 10:82067007-82067029 CTAAATATACAAAAGTTAAGAGG + Intronic
1071138099 10:82475245-82475267 CTAAATTCAGAAATGAAAGAGGG + Intronic
1071526159 10:86360444-86360466 AAAAATATAAAAAAGAAAAAGGG - Intronic
1071684446 10:87739945-87739967 CTACATATACCAATGTACAATGG + Intronic
1071736393 10:88305207-88305229 CTAAATATGGAAAGGAAAGACGG + Intronic
1072024570 10:91442219-91442241 CTAAATATGGAAAGGAAAACTGG - Intronic
1072025127 10:91447376-91447398 CTAAATATGGAAAGGAAAACTGG + Intronic
1072286669 10:93922196-93922218 CTAAATTTCCAAAGGACAAATGG + Intronic
1072377327 10:94830752-94830774 ATAAATATAAAAAATAAAAAAGG - Intronic
1072589614 10:96817461-96817483 ATAAATAAATAAATAAAAAATGG + Intergenic
1073468950 10:103711036-103711058 CTAAAAATAATAATAAAAAACGG + Intronic
1073501962 10:103947825-103947847 TTCAATATACATCTGAAAAATGG - Intergenic
1074056872 10:109930333-109930355 GTAAATAAACACATGAAAAGAGG - Intergenic
1074411027 10:113228819-113228841 CTAAATAAATAAATAAAACAAGG - Intergenic
1074490735 10:113937200-113937222 CTAAATATACACATGATATGAGG - Intergenic
1074621682 10:115131915-115131937 ATAAAAATAAAAATAAAAAAAGG - Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075110537 10:119577544-119577566 CAAAACATACAAATAAAACATGG + Intronic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1075487231 10:122833434-122833456 CTCAAAATCCAAATGAATAATGG + Intronic
1075819926 10:125298238-125298260 CTAAATATAAATGTTAAAAAAGG - Intergenic
1075852778 10:125602650-125602672 CTAAAGACACAAATCAAAGATGG + Intronic
1076039721 10:127235506-127235528 CTAAATAAACAAATAAATTATGG - Intronic
1076076294 10:127536483-127536505 CTAAATAAAAAATTCAAAAATGG + Intergenic
1076134888 10:128038808-128038830 ATATATATACATATAAAAAATGG + Intronic
1077345773 11:2051528-2051550 CAAATTATGGAAATGAAAAATGG - Intergenic
1077618376 11:3696190-3696212 TTAAACATAAAAAGGAAAAATGG + Intronic
1077728511 11:4702431-4702453 CTAAAAAGAAAAATTAAAAAAGG + Intergenic
1078122579 11:8524325-8524347 ATAAATAAATAAATAAAAAACGG + Intronic
1078133335 11:8631939-8631961 GTAAATATGCAATAGAAAAAGGG + Intronic
1078263566 11:9735119-9735141 AAAAATATACAAATATAAAAAGG + Intronic
1078599029 11:12714592-12714614 CTAAATAAATGAATGAAAGAGGG - Intronic
1079231843 11:18655859-18655881 CTAAAAATCCAAAAAAAAAAAGG + Intergenic
1079452762 11:20611461-20611483 AAAAACAAACAAATGAAAAAAGG + Intronic
1079570651 11:21939731-21939753 GTAAATATATAAATATAAAAAGG - Intergenic
1079599522 11:22294151-22294173 ATAAATAAATAAATAAAAAATGG - Intergenic
1079623564 11:22585931-22585953 ATAAATATTCAAATGGTAAATGG - Intergenic
1079644873 11:22850730-22850752 CTAGATATTGAAATGACAAAGGG + Intronic
1079715134 11:23733913-23733935 CTAAATATGGAAAGGAAAACTGG + Intergenic
1079725335 11:23873688-23873710 TTAACTTTACAAAGGAAAAAGGG - Intergenic
1079961041 11:26923644-26923666 CTAATTATCCAATTGAGAAATGG - Intergenic
1080093908 11:28382051-28382073 CCAAATAAACAAAAGAAAGAAGG - Intergenic
1080143360 11:28949308-28949330 TTAAATATCCAAATGCAAGAGGG - Intergenic
1080265329 11:30394369-30394391 TTACTTATAGAAATGAAAAATGG - Intronic
1080371835 11:31656752-31656774 CTAAATATGCAAAGGGGAAAAGG + Intronic
1080459961 11:32445672-32445694 ATAAATATATAAATAAAAGAAGG + Intergenic
1080512876 11:32992432-32992454 ATAAAAATAGAAATAAAAAATGG - Intronic
1080774883 11:35376548-35376570 CAAAAAATGTAAATGAAAAAAGG + Intronic
1080856825 11:36119102-36119124 CTAAAAATAAAAAATAAAAAAGG + Intronic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081196815 11:40171448-40171470 CTAAATATACTAATTAAATGAGG + Intronic
1081202164 11:40229631-40229653 AAACACATACAAATGAAAAAAGG + Intronic
1081239757 11:40690549-40690571 CTGAATATGCCAATGTAAAATGG - Intronic
1081391190 11:42530786-42530808 ATAAATAAAGGAATGAAAAAAGG + Intergenic
1081429098 11:42956351-42956373 TTAAATATACAAAAAAAAATTGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1081800365 11:45854694-45854716 GTAAATAAATAAATAAAAAAGGG + Intronic
1081972845 11:47211878-47211900 CTAAATAAATAAATAAAAATTGG - Intergenic
1082126996 11:48444958-48444980 TTTAATATAGAAATGTAAAATGG - Intergenic
1082201240 11:49371026-49371048 ATAAATTTACAAAAGACAAATGG - Intergenic
1082560578 11:54615939-54615961 TTTAATATAGAAATGTAAAATGG - Intergenic
1082620912 11:55420574-55420596 TTAAATATACAAATACAAAGGGG - Intergenic
1082629274 11:55521658-55521680 TTACATATACAAATAAAACAAGG - Intergenic
1082700781 11:56427629-56427651 AAAAATATTCAAATAAAAAAAGG + Intergenic
1082859833 11:57844895-57844917 CTAAAATCAGAAATGAAAAAGGG + Intergenic
1082861952 11:57865215-57865237 CTAAATGTTCAAAAGAGAAAAGG - Intergenic
1082974542 11:59059139-59059161 CTTAATTTACAAATAAGAAATGG + Intergenic
1083021925 11:59516318-59516340 CTAAAAATACAAAGAAAAATAGG + Intergenic
1083031728 11:59598749-59598771 CTAAAAATACAAAAGTTAAACGG - Intronic
1083042714 11:59703033-59703055 ATAAAAATAAAAATTAAAAAAGG + Intergenic
1083538361 11:63492006-63492028 CTAATTATACAAAGAACAAAAGG + Intergenic
1083567595 11:63733151-63733173 CTAAAAATACAAAAAAAAAAAGG + Intronic
1083701569 11:64482500-64482522 TTAAATATGCATATGAAAAAGGG - Intergenic
1083825289 11:65199134-65199156 ATAAAAATACAAATACAAAAAGG - Intronic
1083984457 11:66203346-66203368 CTAAATAGACACACAAAAAATGG + Intronic
1084221951 11:67687545-67687567 CAAAATATAGAAATAAAACATGG - Intergenic
1084277864 11:68064491-68064513 CTATCTTTACAAATCAAAAAAGG + Intronic
1084297307 11:68221370-68221392 ATAAATAAATAAATAAAAAAGGG + Intergenic
1084711189 11:70844748-70844770 TAAAATATTCAAATGAAGAAAGG - Intronic
1085059920 11:73436042-73436064 CAAAAAATACAAATACAAAAGGG - Intronic
1085614285 11:77983560-77983582 CCAAATAAACACATGAAAAGAGG + Intronic
1085811984 11:79691337-79691359 ATAAATAAACAAAAGAGAAAAGG + Intergenic
1085833148 11:79924052-79924074 TTAAAAATTCAAATGCAAAAAGG + Intergenic
1085879808 11:80453099-80453121 ATAAATAAACAAATAAATAATGG - Intergenic
1086122154 11:83315473-83315495 CTAAAAATACAAAAAAAAACTGG - Intergenic
1086185304 11:84006756-84006778 CTGAATATAGTAAAGAAAAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086560123 11:88158033-88158055 CTAAATTAACAAAGAAAAAAAGG + Intronic
1086654441 11:89335211-89335233 ATAAATTTACAAAAGACAAATGG + Intronic
1086795371 11:91094910-91094932 ATAAATATATAAATATAAAAAGG - Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087193131 11:95277116-95277138 CTTAATATATAAATGACAATAGG - Intergenic
1087406526 11:97737880-97737902 CTCATTACACACATGAAAAATGG - Intergenic
1087711925 11:101563884-101563906 CTAAATGTACAAGTAGAAAATGG - Intronic
1088003085 11:104906380-104906402 AAAAATATACAAATTAAAAATGG + Intergenic
1088008617 11:104972363-104972385 CTCAATACAGAAATGAAAAGCGG + Intergenic
1088306318 11:108412400-108412422 CTACATATACCAATTACAAAGGG + Intronic
1088782060 11:113145310-113145332 CTAAATATAAAAAGCACAAACGG + Intronic
1088835247 11:113573086-113573108 CTAAAAATATTAATGAGAAATGG + Intergenic
1089106581 11:116011732-116011754 CTAAAAATACATAACAAAAAGGG - Intergenic
1089222506 11:116886024-116886046 CTAAATAGAAAAATAAAAGAAGG - Intronic
1089340396 11:117753472-117753494 CTCAATTTTCAAATGAGAAAAGG + Intronic
1089822749 11:121243032-121243054 CAAAATATAGAAAGCAAAAATGG + Intergenic
1090254159 11:125271520-125271542 CTGAATGAACAAATGAAAACAGG - Intronic
1090361280 11:126174695-126174717 TTGAATATATAAATGAAAGATGG - Intergenic
1090754839 11:129781016-129781038 ATAAAAATAAAAATGAAAATTGG - Intergenic
1091382760 12:73082-73104 ATAAATAAATAAATAAAAAAGGG + Intronic
1091575556 12:1731059-1731081 CTAAACAAACAAATAAAATAAGG - Intronic
1091839735 12:3612291-3612313 CTAAATATAAAACTGAAGCAAGG + Intronic
1092338504 12:7655347-7655369 CTAAAAATACAAAAAAAAATTGG + Intronic
1092498188 12:9019084-9019106 CTAATAATACAATTTAAAAATGG + Intergenic
1092620520 12:10260637-10260659 CTAAAAATACAAAAAAAAATTGG + Intergenic
1092760232 12:11803629-11803651 TTAAATATAAAAATCCAAAATGG + Intronic
1092779780 12:11974861-11974883 CCAAAAATACAAATGAGAAAAGG + Intergenic
1093001280 12:13999409-13999431 TTAAATGTAGAAATGAAAAAAGG - Intergenic
1093045657 12:14441412-14441434 CAAAAAATCCAAATTAAAAATGG - Intronic
1093062094 12:14617817-14617839 ATAAAGATACAAATTGAAAATGG - Intronic
1093189189 12:16055661-16055683 ATAAAAATAAAAATAAAAAAAGG + Intergenic
1093228147 12:16510571-16510593 TTAAAAATACAAATTCAAAATGG - Intronic
1093250657 12:16800313-16800335 CGAAACAAACAAATAAAAAAAGG - Intergenic
1093290199 12:17310220-17310242 ATAAAAATAAAAATTAAAAATGG - Intergenic
1093327445 12:17795203-17795225 CAAAATACGCAAATGAAAGATGG + Intergenic
1093343424 12:18008038-18008060 ATAAATAAATAAATGCAAAAAGG + Intergenic
1093413451 12:18894367-18894389 CTAAATATGGAAAGGAAAACTGG - Intergenic
1093428252 12:19053853-19053875 CTAATTATAAAAAAGAACAATGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093530968 12:20163146-20163168 TTACATGTATAAATGAAAAATGG + Intergenic
1093851313 12:24042580-24042602 CTAAATATACTTTTTAAAAAAGG - Intergenic
1094404155 12:30096954-30096976 ATAAATCTTCAAATTAAAAAGGG + Intergenic
1094538574 12:31343848-31343870 ATAAAAATAAAAATAAAAAATGG + Intergenic
1094587831 12:31794214-31794236 CTAAAAATACAAAAAAAAATAGG + Intergenic
1094645806 12:32322977-32322999 CTTAATTTTCAAAGGAAAAAAGG + Intronic
1094788303 12:33877401-33877423 ATAAATACATAAATAAAAAAGGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095129752 12:38526129-38526151 TATAATATCCAAATGAAAAATGG - Intergenic
1095202443 12:39399971-39399993 ATAAATATATAAATGATAAATGG - Intronic
1095348539 12:41181788-41181810 CAAAAAAAAAAAATGAAAAAAGG - Intergenic
1095378783 12:41564012-41564034 ATAAATACTCAAATGAAAAATGG + Intronic
1095543765 12:43341586-43341608 CAAAATATAAAAAGTAAAAATGG - Intergenic
1095556756 12:43515908-43515930 CTAAACATTCATTTGAAAAATGG - Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096016929 12:48285231-48285253 CTCCATCTACAAAAGAAAAATGG - Intergenic
1096380942 12:51157630-51157652 CTAAAGATAAAAATGAAAGTGGG - Intronic
1096612633 12:52813171-52813193 CTGATTTTGCAAATGAAAAAGGG - Intronic
1096775267 12:53959851-53959873 CTAATTATAGGAATAAAAAAGGG - Intergenic
1096935646 12:55271028-55271050 CTAAAGATCCAAATCAACAAAGG - Intergenic
1096939781 12:55329750-55329772 CTAAGTATAAAAAACAAAAATGG + Intergenic
1097012394 12:55962482-55962504 ATAAATAAACAAATAAATAAGGG - Intronic
1097121935 12:56740221-56740243 CTAAATATAGAAATAAAAGTAGG - Intronic
1097217127 12:57422987-57423009 AAAAATATATAAATGAAGAATGG + Intronic
1097248056 12:57617483-57617505 CTAACTCTACAAAAAAAAAAAGG - Intronic
1097392039 12:59026776-59026798 CTAAAAATAGAAAAAAAAAATGG - Intergenic
1097831358 12:64227532-64227554 CAAAATCAACAAATGAAAATTGG - Intergenic
1097947480 12:65388173-65388195 CTAAATATACAAATAATCTAGGG - Intronic
1098527704 12:71505247-71505269 CTAAAAATAAAAACTAAAAAAGG + Intronic
1098814128 12:75136045-75136067 TTAAATATACCAAGAAAAAAAGG - Intronic
1098830210 12:75352009-75352031 CTAAATATGGAAAGGAAAAATGG + Intronic
1098910799 12:76206395-76206417 CTTAATATAGAAATGACAAGGGG - Intergenic
1098932186 12:76431738-76431760 CTAAATATATAAAGCAAACATGG + Intronic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1099087440 12:78262556-78262578 CTAAAAATACAAAAAAAAAAAGG + Intergenic
1099215647 12:79850125-79850147 CAAATTGTAGAAATGAAAAATGG + Intronic
1099290831 12:80774541-80774563 CCAAATAAACAAATCAGAAATGG - Intergenic
1099294033 12:80807707-80807729 CTAAAAGTACAAATGTAAAGTGG + Intronic
1099741151 12:86635975-86635997 CTAAATATAGAAAAGGAACAGGG - Intronic
1099782747 12:87219893-87219915 CTTATTTTATAAATGAAAAACGG + Intergenic
1099840736 12:87962536-87962558 CCAAATATTCCAATTAAAAATGG - Intergenic
1099948126 12:89268371-89268393 CTAAATTGACAAATCTAAAATGG + Intergenic
1100011977 12:89964609-89964631 ATAAATAAATAAATGAAAAAAGG - Intergenic
1100574881 12:95881722-95881744 ATGAATATACAAAAGAAAATTGG + Intronic
1100703894 12:97179427-97179449 CTAAAGTCACAAATGCAAAATGG - Intergenic
1100704394 12:97184535-97184557 AGAAATTTACAAATGAACAAAGG - Intergenic
1100755013 12:97741654-97741676 TTAAATATATAAATTAACAAAGG - Intergenic
1100791940 12:98140093-98140115 CTAAATATGAATATGAATAACGG + Intergenic
1101010490 12:100444386-100444408 CTATATTACCAAATGAAAAAGGG - Intergenic
1101250874 12:102933775-102933797 CTAATAATCCAATTGAAAAATGG - Intronic
1101391336 12:104303262-104303284 CTCATTATACAAATGTAAATCGG - Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1101901743 12:108795876-108795898 TTAAATATATAAATAAAAAGAGG - Intronic
1101981493 12:109411147-109411169 ATAAAAATAAAAATAAAAAAAGG + Intronic
1102052232 12:109871246-109871268 CTAAAAATACAAAAAAAAATTGG - Intronic
1102110945 12:110365469-110365491 GTAAAAATAAAAATGAAACAAGG + Intergenic
1102118376 12:110420932-110420954 CTAAATAAATAAATAAAAATTGG - Intergenic
1102198474 12:111041301-111041323 CTAAAAATACCAATGACAATAGG - Intronic
1102695135 12:114792949-114792971 CTAAAAAAAAAAAAGAAAAAAGG + Intergenic
1102863538 12:116356668-116356690 CCAAATAAATAAATGAAAGAAGG + Intergenic
1103533918 12:121621604-121621626 CTAAATAAATAAATGAATCATGG - Intergenic
1103632384 12:122272481-122272503 CTAAATATACAAATGCAGCCTGG + Exonic
1103673818 12:122640187-122640209 CTCATTATACATAAGAAAAATGG - Intergenic
1103769800 12:123312733-123312755 CCAAATACACGAAAGAAAAAAGG + Intronic
1103809080 12:123599683-123599705 CTAAAAATTCAACTGAAAATAGG + Intergenic
1103999281 12:124850071-124850093 CTAAATAAATAAATAATAAAGGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104101123 12:125611122-125611144 CTAAAAAGACAAATAAAAATTGG - Intronic
1104116138 12:125750398-125750420 ATAAATATAAAAATAATAAATGG - Intergenic
1104120487 12:125794502-125794524 ATAAATCTAAAAATGCAAAATGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104494511 12:129224384-129224406 TTAAATATACACATTTAAAATGG + Intronic
1105051988 12:133062630-133062652 CTATGTATACATGTGAAAAATGG - Exonic
1105399574 13:20077136-20077158 CTAAATTAACCAATGAAAGAAGG - Intronic
1105688546 13:22812121-22812143 CTAAATATTTCAATGATAAAAGG + Intergenic
1105879951 13:24595694-24595716 ATAAATATAAAAAGGAATAAAGG + Intergenic
1105919904 13:24953417-24953439 ATAAATATAAAAAGGAATAAAGG - Intergenic
1105960220 13:25327842-25327864 CTAAATATCCAACAGAAAATGGG - Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106167390 13:27260619-27260641 CTACATATTCATATGCAAAATGG - Intergenic
1106645209 13:31626728-31626750 CTAAATAGCAAAATGAATAAAGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106939082 13:34756603-34756625 ATAAATACACAAAGCAAAAATGG + Intergenic
1106980048 13:35269063-35269085 GGACACATACAAATGAAAAAAGG + Intronic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107100433 13:36584910-36584932 CTAAAGATAAACAGGAAAAAAGG - Intergenic
1107103421 13:36618446-36618468 CCAAATATACAAAAAAAGAAAGG - Intergenic
1107256800 13:38437016-38437038 ACAAATAAACAAATGAAAATAGG + Intergenic
1107381728 13:39863739-39863761 GTAAAAATTAAAATGAAAAAAGG + Intergenic
1107485647 13:40824863-40824885 ATAAATATATAAAGGAATAAAGG - Intergenic
1107621479 13:42235520-42235542 TTACATATACAAACTAAAAAAGG + Intronic
1107688040 13:42923564-42923586 ATAAATAAATAAATAAAAAATGG + Intronic
1107705830 13:43103786-43103808 CAAAATATACAAAGGAAAAAAGG - Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108118204 13:47153840-47153862 CTAAATAAATAAATCTAAAAGGG + Intergenic
1108280942 13:48861001-48861023 CTAAAATAACAAAAGAAAAATGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108500059 13:51061612-51061634 TAAATTACACAAATGAAAAAGGG - Intergenic
1108625209 13:52221883-52221905 ATAAATATATAAAGGAATAAAGG - Intergenic
1108660848 13:52584533-52584555 ATAAATATATAAAGGAATAAAGG + Intergenic
1108734145 13:53264921-53264943 CTAAGTAGACAAAGGAGAAAAGG - Intergenic
1108776900 13:53776728-53776750 CTCAATTTAAAAATGAAATAAGG + Intergenic
1108851922 13:54740470-54740492 ATAAATAAATAAATAAAAAATGG - Intergenic
1108923735 13:55710806-55710828 ATAAATATATAATTGCAAAAGGG + Intergenic
1109408206 13:61928286-61928308 CTAAGCATACAAATGAAAAATGG - Intergenic
1109664499 13:65514534-65514556 CTAAATTAAACAATGAAAAATGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1109964220 13:69670567-69670589 CAAAATACACAAATCAATAAAGG + Intergenic
1109980134 13:69896622-69896644 ATAAATAGAAAGATGAAAAAGGG + Intronic
1110050049 13:70885529-70885551 GTAAACTTACAAAAGAAAAAGGG + Intergenic
1110124326 13:71923497-71923519 CTAAATACACACATTAATAATGG + Intergenic
1110252795 13:73399585-73399607 CTAAATATTTAAATGAGAACTGG - Intergenic
1110357964 13:74590312-74590334 CTGAATGCATAAATGAAAAAAGG + Intergenic
1110437787 13:75494742-75494764 CTGAATCTACAAAAGAGAAAGGG + Intergenic
1110489083 13:76081371-76081393 ATATTTATACGAATGAAAAATGG + Intergenic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1111228666 13:85311255-85311277 CAAAATGAAGAAATGAAAAAAGG + Intergenic
1111324057 13:86668211-86668233 TTAAAAATACAAAAGAAACACGG - Intergenic
1111338248 13:86849432-86849454 CTAAATACGAAAAGGAAAAATGG + Intergenic
1111382987 13:87483919-87483941 CTAAATATATATATGAAATGAGG - Intergenic
1111461602 13:88551214-88551236 CTAAATAGATATATGACAAATGG - Intergenic
1112405530 13:99116615-99116637 CTAAGTATAAAAAACAAAAATGG - Intergenic
1112486299 13:99823069-99823091 ATAAGTATACAAATCAAACATGG - Intronic
1112488460 13:99840784-99840806 TTACATATGCATATGAAAAAAGG + Intronic
1112614806 13:100993050-100993072 CTAGATTTACAAAGAAAAAATGG + Intergenic
1112642773 13:101295588-101295610 CTAATTGGACAAAGGAAAAAAGG + Intronic
1112702342 13:102024947-102024969 ATATATATACATATGTAAAATGG + Intronic
1112918255 13:104577951-104577973 TTAAATATTAAAATGAAAAAGGG + Intergenic
1113095363 13:106658000-106658022 CAAACTATTCAATTGAAAAAGGG - Intergenic
1113194683 13:107788342-107788364 CCAAATAGAAAAATTAAAAAGGG - Intronic
1113310052 13:109122366-109122388 CTAAAGATAAAAATTAAGAATGG + Intronic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1113838056 13:113342340-113342362 CTAAAAATACAAAAAAAAATTGG + Intronic
1114274131 14:21126302-21126324 CTAAATATATAAAGCAAATATGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1114961699 14:27899603-27899625 ATAAATATACAAATAAACCAAGG + Intergenic
1115023628 14:28713805-28713827 CTTAATATACAAAGAAGAAAAGG + Intergenic
1115122575 14:29955171-29955193 CAAAATATAAAAATGCAAAGTGG - Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115439681 14:33418655-33418677 TTAAAAATAAAAATAAAAAATGG - Intronic
1115547683 14:34477727-34477749 ATAAATAAATAAATAAAAAATGG - Intergenic
1115560644 14:34579876-34579898 TTATATATAAAAATAAAAAAGGG + Intronic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1115603485 14:34977899-34977921 CTAATTAGGAAAATGAAAAATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116199148 14:41769859-41769881 AGAAATAGACAAATGAAAACTGG - Intronic
1116266763 14:42701419-42701441 ATAAATATATAAATGATAATGGG + Intergenic
1116565613 14:46440479-46440501 CTAAATATGGAAAGGAAAAATGG + Intergenic
1116625610 14:47259084-47259106 CTAAACAAACAAATGGAAATTGG - Intronic
1116666132 14:47778010-47778032 ATAAATTAACAAATGAGAAAGGG - Intergenic
1116794312 14:49373658-49373680 CTAAAAATAAAAATAAAAGATGG + Intergenic
1117127186 14:52641614-52641636 CAAAAAATAAAAATAAAAAAAGG + Exonic
1117200346 14:53383735-53383757 CTAAAAAAAAAAAAGAAAAAAGG - Intergenic
1117753461 14:58947903-58947925 ATAAATATGCAAATGTAAAGTGG - Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1117883240 14:60332125-60332147 GTCAATTTACAAATGAGAAACGG - Intergenic
1117902796 14:60552413-60552435 CTAAATACACAAATTAAGATAGG - Intergenic
1118154674 14:63227457-63227479 CTAAATATATAAATTACATAGGG - Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118601952 14:67476962-67476984 CTAAAAATACAAAAAAACAATGG + Intronic
1118611496 14:67544111-67544133 CAAAATTTAAAAATAAAAAATGG + Intronic
1118644488 14:67824254-67824276 CTAAACAAACAAACAAAAAAAGG - Intronic
1118692766 14:68355674-68355696 CTAAAAGTACAAAGGAAAAATGG + Intronic
1119549874 14:75501052-75501074 CTTAATATAAAAATAAAAATTGG - Intergenic
1120046511 14:79813539-79813561 ATAGATATACAAATCAAACAAGG + Intronic
1120165083 14:81189285-81189307 CAAAATACAAAAAGGAAAAATGG + Intronic
1120353583 14:83397481-83397503 CTAAAGCTAGAAATGAAAGAGGG + Intergenic
1120440018 14:84524631-84524653 TTAAATATGGAAAAGAAAAAAGG - Intergenic
1120487746 14:85136138-85136160 ATAAATAAATAAATAAAAAATGG + Intergenic
1120592874 14:86396316-86396338 CTACTTTTTCAAATGAAAAATGG + Intergenic
1120679863 14:87468015-87468037 CTAAAAATACAAAAAAAAAAGGG - Intergenic
1120805196 14:88739751-88739773 CCTAATATTCAAATGAATAAAGG + Intronic
1121905660 14:97740732-97740754 CTAAATATGGAAAGGAAAAACGG - Intergenic
1122426726 14:101613406-101613428 ATAAAAATAAAAATGAAAGATGG + Intergenic
1122431072 14:101644897-101644919 CTAGATAGACAAAAAAAAAAAGG + Intergenic
1122758653 14:104003333-104003355 CTTAATAAACAAAAGACAAAGGG + Intronic
1123153157 14:106201892-106201914 CAAGATAAACAAAGGAAAAAAGG - Intergenic
1123693197 15:22856720-22856742 GTTAATAAACAAATGAAAATGGG + Intronic
1123773342 15:23551991-23552013 TTAGATACACAAATAAAAAAAGG - Intergenic
1123800439 15:23814236-23814258 ATAAATATCCAAATGATTAAGGG - Intergenic
1123806978 15:23883892-23883914 CTAAAAAAACAAATATAAAAAGG - Intergenic
1123808003 15:23895220-23895242 CTACATATAAAGATTAAAAATGG - Intergenic
1123887410 15:24740363-24740385 GCAAACATACAAATTAAAAATGG - Intergenic
1123893089 15:24801095-24801117 TCAAATATCCAAATTAAAAATGG - Intergenic
1123912485 15:24982187-24982209 ATATCTATACAAATAAAAAAGGG - Intergenic
1124046332 15:26154135-26154157 CTAAATATGGAAAGGAAAAACGG - Intergenic
1124064429 15:26326878-26326900 CTCAAAATAAAAATTAAAAAAGG + Intergenic
1124088552 15:26575855-26575877 CCAAATGTACCAAAGAAAAAAGG + Intronic
1124191751 15:27584622-27584644 CAAAAAATACAAACAAAAAATGG + Intergenic
1124196049 15:27630491-27630513 CTAAAAATACAAAAAACAAAAGG + Intergenic
1124287035 15:28410778-28410800 CTAAAAATACAAAAAAAAAAAGG + Intergenic
1124295666 15:28500849-28500871 CTAAAAATACAAAAAAAAAAAGG - Intergenic
1124400397 15:29342790-29342812 ACAAATATCCAAAAGAAAAATGG - Intronic
1124515862 15:30367118-30367140 CTAAAAATACAAAAAAAAATTGG + Intronic
1124528492 15:30480621-30480643 CTAAATATAAAAAAGCAAATAGG - Intergenic
1124712263 15:32024149-32024171 TTCAAAATACTAATGAAAAAAGG + Intergenic
1124727058 15:32163613-32163635 CTAAAAATACAAAAAAAAATTGG - Intronic
1124770165 15:32527077-32527099 CTAAATATAAAAAAGCAAATAGG + Intergenic
1124916718 15:33982399-33982421 CCAAAAATAAAAATTAAAAAAGG + Intronic
1124932781 15:34138333-34138355 TTAAATATAGCATTGAAAAATGG + Intergenic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125073365 15:35582959-35582981 TTAGATAGACAAATGAACAAAGG + Intergenic
1125470532 15:39998286-39998308 TTAAACATGCAGATGAAAAAAGG - Intronic
1125621211 15:41063997-41064019 CAAAATATATAAAGCAAAAATGG + Intronic
1126096406 15:45093971-45093993 ACAATTATACAAATGAGAAAAGG - Exonic
1126149739 15:45512995-45513017 CTAAAAAAAAAAAAGAAAAATGG + Intronic
1126392650 15:48176720-48176742 TTAAAAATAGAAATGAAAACCGG - Intronic
1126430552 15:48579008-48579030 ATAAAAATAAAAATAAAAAAGGG + Intronic
1127187891 15:56498942-56498964 TTAAATATGCAAATGTATAAAGG - Intergenic
1127789057 15:62382061-62382083 ACAAATAGACAAATGAAACATGG - Intergenic
1128083175 15:64868329-64868351 CTAAAAATACAAAAAAAAACGGG - Intronic
1128375511 15:67071819-67071841 ATAAATAAATAAATGAAAAGTGG + Intronic
1128461672 15:67873498-67873520 CAAAACACACAAATGATAAAGGG + Intergenic
1128907561 15:71481640-71481662 CTTAATGAACAAATGAAAAGGGG - Intronic
1129075377 15:72990910-72990932 CTAAAAGCACAAATGACAAAAGG + Intergenic
1129243854 15:74268139-74268161 TGAAATATTCAAATGGAAAAGGG + Intronic
1130065348 15:80598281-80598303 ATAAATAAACAAATAATAAAAGG + Intergenic
1130199240 15:81809864-81809886 ATAAAAATAGAAATGAACAAGGG - Intergenic
1130215693 15:81966874-81966896 CTACATAAACAAATGTAAATGGG + Intergenic
1130284287 15:82542203-82542225 CTAAATAAATAAATAAATAAAGG - Intronic
1131033715 15:89207230-89207252 CTAAATATATAAATGAAATCAGG - Intergenic
1131101867 15:89697787-89697809 CAAAATACACAAAGTAAAAATGG - Intronic
1131137216 15:89946622-89946644 CCAAGTATATACATGAAAAACGG + Intergenic
1131164242 15:90130727-90130749 ATAAATAAATAAATGAATAAAGG + Intergenic
1131476511 15:92744670-92744692 CTAAATAAATAAATAAGAAATGG - Intronic
1131492572 15:92875724-92875746 ATAAATAAACAAATAAAATACGG - Intergenic
1131773787 15:95771507-95771529 ATAAATATATCAATGTAAAAAGG + Intergenic
1131942406 15:97581961-97581983 CACAATATAAAAATGATAAAGGG - Intergenic
1132100907 15:99022615-99022637 ATAAATAAACAAATAAAAGAAGG - Intergenic
1132242845 15:100273545-100273567 CTAATAACACAAATGAAAACAGG - Intronic
1132526809 16:420652-420674 CTAAAAAAATAAATGAAAAATGG + Intergenic
1132785266 16:1653514-1653536 TAAAATGTACAAATGAAAAAGGG - Intronic
1133145901 16:3786361-3786383 CTCAAAAAACAAAAGAAAAAAGG + Intronic
1133943869 16:10332506-10332528 CTAAAAAAAAAAATTAAAAAGGG - Intronic
1133953141 16:10415460-10415482 CTATATATAAAAAGGCAAAATGG + Intronic
1133957806 16:10461004-10461026 CAAATAATACAAAAGAAAAATGG + Intronic
1134177729 16:12021724-12021746 CTAAAAATACACACAAAAAATGG + Intronic
1134249700 16:12565763-12565785 CTAGATGTGAAAATGAAAAAAGG - Intronic
1134401321 16:13912942-13912964 CTAAAACTAAAAATGAATAATGG + Intergenic
1134638407 16:15809999-15810021 GTAAATATTAAATTGAAAAAGGG - Intronic
1134698504 16:16244296-16244318 ATAAAAATAAAAATAAAAAAAGG - Intronic
1135140871 16:19920901-19920923 CTAATTATCCAATTTAAAAATGG - Intergenic
1135305844 16:21366981-21367003 ATATATATATATATGAAAAAAGG - Intergenic
1135677263 16:24426758-24426780 CTAAGTATCCAATTAAAAAATGG - Intergenic
1135727414 16:24867657-24867679 ATAAAATTAGAAATGAAAAAGGG + Intronic
1136061297 16:27728425-27728447 ATAAATAAACAAATAAATAAAGG - Intronic
1136302585 16:29346136-29346158 ATATATATATATATGAAAAAAGG - Intergenic
1136489045 16:30593362-30593384 CTAAATTAAAAAAAGAAAAAAGG + Intergenic
1136641825 16:31571864-31571886 TTAAATATCTACATGAAAAAGGG + Intergenic
1136968244 16:34941172-34941194 CTAAAAATACAAAAAAATAACGG - Intergenic
1137253382 16:46756551-46756573 ATAAATACACAAATCAACAAAGG - Intronic
1137402110 16:48162361-48162383 CTACACATACAAAGGAAATAAGG + Intergenic
1137516777 16:49151744-49151766 ATGAAATTACAAATGAAAAAAGG + Intergenic
1137588863 16:49681323-49681345 CTAAATAACAAAATGAAACATGG + Intronic
1137702069 16:50504413-50504435 ATAAATAAATAAATAAAAAAGGG + Intergenic
1137913835 16:52406673-52406695 CTAACTATACAGAGGAAAAATGG + Intergenic
1137967566 16:52951942-52951964 CTAGATATATAAAAGATAAAAGG + Intergenic
1138058447 16:53861604-53861626 CTAAATACAAAATTGAAAATTGG - Intronic
1138685321 16:58720202-58720224 CTAAATAAATAAATAAATAAAGG + Intronic
1138689878 16:58757283-58757305 CTAAATTTAAAAATGTAAACAGG - Intergenic
1138777996 16:59748399-59748421 ATAAATCTACAAAGAAAAAAAGG - Intronic
1138810551 16:60145105-60145127 ATAAAAATGCAAATTAAAAAAGG + Intergenic
1138934665 16:61704332-61704354 CTCAATAAACATATGACAAATGG - Intronic
1138995790 16:62451641-62451663 TTAAATAATTAAATGAAAAAGGG + Intergenic
1139029254 16:62859555-62859577 CCCATTATACAAATGCAAAATGG + Intergenic
1139357512 16:66375943-66375965 CTAAAAATACAAAAAAAAATTGG + Intronic
1139535601 16:67570918-67570940 CTAAATATATAAAGGACTAAAGG - Intronic
1139707826 16:68753951-68753973 CTAAAAATACAAAAAAAAATTGG + Intronic
1140345794 16:74212039-74212061 CTAAATGTAGAAAGGACAAATGG + Intergenic
1140377699 16:74458065-74458087 CTTCATATACTAATAAAAAAGGG + Intronic
1140403340 16:74689905-74689927 CTAAATATAAAAAATAAAACTGG + Intronic
1140537920 16:75727910-75727932 ATAAATATACAACTAAAAATAGG + Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1141104193 16:81219703-81219725 ATAAATAAATAAATAAAAAATGG + Intergenic
1141135370 16:81461315-81461337 CTAATTATAAAAACAAAAAAAGG - Intronic
1141209712 16:81965832-81965854 TTGAAAATAAAAATGAAAAAAGG - Intergenic
1142632978 17:1237891-1237913 AAAAATATAAAAATAAAAAAAGG - Intergenic
1142720487 17:1772549-1772571 ATAAATAAATAAATGTAAAAGGG - Intronic
1142822624 17:2483226-2483248 CTACAAATAAAAATGAAAATAGG + Intronic
1143060995 17:4200958-4200980 CTGTATATTCAAATGAAAATGGG - Intronic
1143345915 17:6248918-6248940 CAAAACATCCCAATGAAAAATGG + Intergenic
1143605004 17:7978379-7978401 CTAAAAATACAAAAAAAAATTGG + Intergenic
1143899698 17:10164826-10164848 CTAAAAATAATAATGAAAAAAGG + Intronic
1143932613 17:10445510-10445532 CTATATATAGAAAGGAGAAAAGG - Intronic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1144288603 17:13804150-13804172 ATAATTATACATATAAAAAAGGG + Intergenic
1144302958 17:13940188-13940210 CTAAAATTACAAGTGAAAGAAGG + Intergenic
1144308355 17:13989908-13989930 CTAAACATACAAGCAAAAAAAGG + Intergenic
1144604144 17:16649523-16649545 CTAAATAGACCCATGAAAATTGG - Intronic
1144647138 17:16982824-16982846 CTAAAAATACAAAAAAAAATTGG - Intergenic
1145930145 17:28679541-28679563 CTAAAAATACAAAAAAAAACCGG - Intronic
1145947744 17:28790260-28790282 CTAAAAATACTAATTACAAAGGG + Intronic
1146120013 17:30184467-30184489 CTGATTATCCAAATGCAAAAAGG - Intronic
1146801633 17:35828808-35828830 CTAAATTTTAATATGAAAAAAGG - Intronic
1147279269 17:39344791-39344813 ATAAAAATAAAAATTAAAAAAGG + Intronic
1147297169 17:39493301-39493323 CAAAAAATAAAAATAAAAAAAGG - Intronic
1147490514 17:40861759-40861781 CTAAAGATAAAAATGGAATAAGG + Intronic
1147698845 17:42378595-42378617 CTAAACATACTGATGAAAAGAGG + Intronic
1148011620 17:44486641-44486663 CAAATAATACAAATGTAAAATGG + Intronic
1148043376 17:44726287-44726309 ATAAATAAATAAATAAAAAAGGG - Intronic
1148310896 17:46638675-46638697 CTAAAAATACAAAAAAAAAATGG - Intronic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148515978 17:48217645-48217667 CTAAATAAATAAATAAGAAAAGG + Intronic
1148526741 17:48345815-48345837 CTAGATACAAAAATGACAAAAGG + Intronic
1148611815 17:48969717-48969739 ATAAAAATAAAAATAAAAAAGGG + Intergenic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1148883765 17:50756140-50756162 ATAAACATACAGATTAAAAAAGG - Exonic
1149025409 17:52021657-52021679 CTAGATTAACAAAGGAAAAAAGG + Intronic
1149075525 17:52593516-52593538 CTAAACAAACAAATTAAATAAGG - Intergenic
1149190210 17:54051853-54051875 AAAAATATACAAATACAAAATGG + Intergenic
1149380027 17:56084343-56084365 CCAAAGCTACAAAAGAAAAAAGG - Intergenic
1149420723 17:56508542-56508564 GTAAATATACAAACGATAAGAGG - Intronic
1149735244 17:58987786-58987808 CTAGATAAAAAAATTAAAAATGG + Intronic
1150027904 17:61697514-61697536 CTAAAATTAGAAATGAAAGAGGG - Intronic
1150047340 17:61926669-61926691 GTAAAAATACAAATGAAAGTAGG + Intronic
1150151115 17:62809359-62809381 CTAAATATGCAAAGTAAATAGGG - Intergenic
1150180738 17:63118339-63118361 CTAAAAATACAAGTAAACAAAGG - Intronic
1150297706 17:64022363-64022385 CTAAAAAAAAAAAAGAAAAAAGG - Intergenic
1150415134 17:64981441-64981463 CTAAATATACAAATGACCCTTGG + Intergenic
1150563904 17:66321081-66321103 CAAAATATACAAAATAACAATGG + Intronic
1150654252 17:67029466-67029488 CTAAAAATACAAAAAAAAATTGG + Intronic
1150976666 17:70095230-70095252 CTGAATATACAAATAAATACTGG + Intronic
1151083864 17:71359070-71359092 ATAAATACACCAAAGAAAAATGG - Intergenic
1151204798 17:72498413-72498435 CTAAATAAACATTTGTAAAACGG + Intergenic
1151282252 17:73085343-73085365 CTAAAAATACAAAAAAAAATAGG + Intronic
1151287252 17:73121806-73121828 ATAAAAATAAAAATAAAAAAAGG - Intergenic
1151987641 17:77554329-77554351 CTAAAAATACAAAAAAAAATTGG - Intergenic
1152419847 17:80186533-80186555 CAAAAAATAAAAATAAAAAAAGG - Intronic
1153070757 18:1101696-1101718 CAAAACAAACAAACGAAAAAAGG - Intergenic
1153109662 18:1570091-1570113 CTAAATAAACTTAAGAAAAACGG - Intergenic
1153233504 18:2963702-2963724 CAAAATGTGGAAATGAAAAATGG + Intronic
1153267804 18:3288172-3288194 CTAATTATTCAATTTAAAAATGG - Intergenic
1153286392 18:3458825-3458847 CTAAATGTACCACTGAACAAAGG - Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1153690440 18:7587301-7587323 CTATTTATAAAAATGAAAAATGG - Intronic
1154147505 18:11878563-11878585 CCAAATAAACAAACTAAAAAAGG - Intronic
1154179881 18:12126478-12126500 CAAAATATATACATGATAAACGG + Intronic
1155481581 18:26294584-26294606 GTACATATAAAAATGCAAAAGGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155806989 18:30183852-30183874 CTGAAAATATAATTGAAAAATGG + Intergenic
1155931430 18:31713049-31713071 CTAAATATAAAAATTATAAGTGG + Intergenic
1156181249 18:34607541-34607563 CTAAATAAATATATAAAAAATGG + Intronic
1156357463 18:36354638-36354660 CTAAAAATACAAAACAAAATTGG + Intronic
1156402649 18:36753880-36753902 CTAAAAAGACAAATAAAAAATGG - Intronic
1156567616 18:38213151-38213173 CTAAAGATAATAATGATAAAAGG - Intergenic
1156960111 18:43017735-43017757 CTATTTCTCCAAATGAAAAATGG - Intronic
1157017884 18:43740882-43740904 CTAAATAAATAAATAAATAAAGG + Intergenic
1157031993 18:43922281-43922303 TCAAATATTCAAATAAAAAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157270132 18:46268084-46268106 CAAAAAATAAAAATAAAAAAAGG + Intergenic
1157387535 18:47270912-47270934 ATAAATATCCAAAAGAAAGAAGG - Intergenic
1157614160 18:48976865-48976887 TTAAAAATACAAAAAAAAAAGGG + Intergenic
1157633102 18:49120178-49120200 GAAAAAATGCAAATGAAAAAGGG + Intronic
1157992027 18:52508820-52508842 CACAATTTACAGATGAAAAAAGG + Intronic
1158034581 18:53010398-53010420 CTAAATATGCAAATAAATATTGG - Intronic
1158758808 18:60359505-60359527 CTAAAAATACAATACAAAAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159242851 18:65765456-65765478 CTAAAAAAAAAAAAGAAAAAAGG - Intronic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159746983 18:72249008-72249030 TTAAAAATATAAATGAATAAAGG - Intergenic
1159940861 18:74407072-74407094 TTAAAAATAAAAATAAAAAAAGG - Intergenic
1160271557 18:77389982-77390004 TTAAAGATATAAATGCAAAACGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161928198 19:7317251-7317273 CTAAATATACAAAAAATAACTGG - Intergenic
1161937712 19:7382414-7382436 CTAAATAAATAAATAAATAAAGG + Intronic
1162289225 19:9766256-9766278 CTAAAAATACAAAGAAAAATGGG + Intronic
1162596206 19:11631190-11631212 CTAATAATTCAAATTAAAAATGG + Intergenic
1162612844 19:11769433-11769455 ATACATAAACCAATGAAAAATGG - Intronic
1162776376 19:12982236-12982258 ATAAATAAACAAGAGAAAAAAGG - Intergenic
1162944489 19:14033971-14033993 CTAAAAATAAAAAATAAAAAAGG + Intronic
1163760882 19:19135874-19135896 CTAAAAATAAAAATAAAAATAGG - Intronic
1163855012 19:19694811-19694833 ATAAATAAAAAAAAGAAAAATGG - Intergenic
1164395880 19:27862462-27862484 ATATATATATATATGAAAAAAGG - Intergenic
1164727737 19:30477948-30477970 CTAAAAAGAAAAAGGAAAAAAGG - Intronic
1164836150 19:31356331-31356353 CTAAATTTACAATTTACAAACGG + Intergenic
1164844110 19:31417321-31417343 CTAAAGTTACTAATTAAAAAAGG - Intergenic
1165086308 19:33350372-33350394 CTAAATACATAAATAAAAATAGG + Intergenic
1166238140 19:41471279-41471301 CCAAATATCCAGAGGAAAAAAGG - Intergenic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
1166405686 19:42520354-42520376 CTAAATAAATAAATAAATAAAGG - Intronic
1167674524 19:50876086-50876108 AGAAATAGACAAATGAGAAAAGG - Intronic
1167846111 19:52165982-52166004 ATAAAAATAAAAATAAAAAAAGG - Intronic
1167909118 19:52687313-52687335 CTATATATATAATTGTAAAACGG - Intronic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168635810 19:57996071-57996093 AAAAATTTAGAAATGAAAAAGGG + Intronic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
1168695009 19:58399181-58399203 ATAAATAAATAAATGAAATAAGG - Intergenic
1202699175 1_KI270712v1_random:150527-150549 CTCACTTTACAAATGAGAAAAGG - Intergenic
925539111 2:4947372-4947394 CTAAAAATACAAATAATAAATGG - Intergenic
925618583 2:5768160-5768182 GTAAATATTCAATTGAGAAATGG + Intergenic
925696156 2:6581374-6581396 ATAAATTTAAAAATTAAAAATGG + Intergenic
926382196 2:12301860-12301882 CAAAATAGATAAATGAAGAAGGG + Intergenic
926491894 2:13534039-13534061 CTAAAAATGTAAATGGAAAATGG + Intergenic
926530815 2:14042501-14042523 CTAAATAAATAAATGATAGAAGG - Intergenic
926538115 2:14139283-14139305 CTAAATACATAAAGCAAAAATGG + Intergenic
926887086 2:17607747-17607769 ATAAATTAACAAATGAATAAAGG + Intronic
927356817 2:22183518-22183540 CTAAAAAGATCAATGAAAAATGG - Intergenic
927540464 2:23906173-23906195 CTAAAAATACAAAAAAAAATTGG + Intronic
927589570 2:24341853-24341875 CAAAAAATACATAGGAAAAAAGG + Intronic
927756288 2:25710891-25710913 CTAAATTCAGAAATGAAAGAGGG + Intergenic
928180667 2:29066152-29066174 ATAAAAATAAAAATTAAAAAAGG + Intronic
928238323 2:29564619-29564641 TTAAAAATAGAAATGATAAAAGG + Intronic
928575945 2:32655152-32655174 CTAAAAATACAAAAAAAAATTGG - Intronic
928718282 2:34089134-34089156 CTAAATAAATAAATAAAAAGTGG - Intergenic
928836528 2:35553874-35553896 CTCAATAGAAAATTGAAAAAAGG - Intergenic
928844104 2:35648289-35648311 ATAAATATATTAATGAGAAAAGG - Intergenic
928862043 2:35870598-35870620 CTAAAAATACATATCAAAAGAGG + Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929062605 2:37938743-37938765 CTAAATAAAAAAATGATAAAGGG - Intronic
929177498 2:38995838-38995860 ATACATACACAAATGAAAATTGG - Intronic
929240016 2:39644303-39644325 CTAAATATACATTTGAAAAAAGG + Intergenic
929321556 2:40549601-40549623 ATAAAAATAAAAATGCAAAAAGG - Intronic
929605253 2:43229633-43229655 CTGAAATTATAAATGAAAAATGG + Intergenic
929735322 2:44541965-44541987 CTAAAAATACAAATTAAACCGGG + Intronic
929767170 2:44855115-44855137 CAAAATATATAAAGTAAAAAAGG + Intergenic
930255003 2:49080494-49080516 CCAAATTTTAAAATGAAAAAAGG + Intronic
930389136 2:50738008-50738030 CCAAATATGCAAATCCAAAAAGG + Intronic
930441781 2:51417678-51417700 GTAATTATAAAAATGATAAAGGG + Intergenic
930521495 2:52472871-52472893 ATAAATATATAAATAAAACAAGG - Intergenic
930621534 2:53649227-53649249 CTAAGTATAGGAATGAACAAGGG - Intronic
930626459 2:53703767-53703789 GAAAATATACAAATGAGAAAAGG + Intronic
930951729 2:57150723-57150745 CAAAATACACAAATCAATAAAGG + Intergenic
931620233 2:64202787-64202809 ATAAATAAACTAATAAAAAAAGG - Intergenic
931664162 2:64598402-64598424 ATAAATAAATAAATAAAAAAGGG - Intergenic
931740503 2:65238356-65238378 CTAAATGTAAAAATGTAAATAGG + Intronic
931765045 2:65447637-65447659 CTAATAATACAATTTAAAAATGG - Intergenic
931857667 2:66320070-66320092 AAAAATAAACAAATGAAACAAGG + Intergenic
932539338 2:72635935-72635957 CTAAAGATACAACAGAAGAAAGG + Intronic
932597833 2:73105239-73105261 CAAAAAATAAAAATAAAAAAAGG - Intronic
932637588 2:73405433-73405455 CTAAATTCAGAAATGAAAGAGGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933116117 2:78474293-78474315 TAAAATATAAAATTGAAAAATGG - Intergenic
933166430 2:79081891-79081913 CTAAATATGAAAAGGAAAACTGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933327531 2:80857666-80857688 CAAAATACACAATTGAGAAATGG + Intergenic
933388445 2:81640715-81640737 ATAAAGCTAGAAATGAAAAATGG + Intergenic
933448211 2:82409805-82409827 CTAAGTATACAAATATAAAAGGG + Intergenic
933464338 2:82633032-82633054 CAAAATAGCCAATTGAAAAATGG - Intergenic
933523572 2:83406858-83406880 CTAAATAAAGAAATGAAGAGTGG - Intergenic
933556985 2:83843005-83843027 CTAGAATTACAAATGAAAGAGGG + Intergenic
933690759 2:85177713-85177735 AAAAATAAAAAAATGAAAAAAGG + Intronic
933909422 2:86926362-86926384 TGAAATATACAAATGGTAAAAGG + Intronic
933959736 2:87400361-87400383 CTAAATATACAAAAAAAATAGGG + Intergenic
934023304 2:87977017-87977039 TGAAATATACAAATGGTAAAAGG - Intergenic
934139350 2:89030859-89030881 CTAAAAATGCAAAAAAAAAAGGG - Intergenic
934170124 2:89534012-89534034 CTCACTTTACAAATGAGAAAAGG - Intergenic
934244298 2:90294409-90294431 CTAAATATACAAAAAAAATAGGG + Intergenic
934264553 2:91503021-91503043 CTAAATATACAAAAAAAATAGGG - Intergenic
934280426 2:91608320-91608342 CTCACTTTACAAATGAGAAAAGG - Intergenic
934696731 2:96405537-96405559 CAAAAAATAAAAATGAAAAGAGG - Intergenic
934854363 2:97719640-97719662 CTAAAAATGCTAATGAAAATAGG - Intronic
934959217 2:98653469-98653491 CTAAAAGTAGAAATGAAAGAGGG + Intronic
935119304 2:100167790-100167812 CAAAATATATGAATCAAAAATGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935514191 2:104015435-104015457 CAAAATCCACAAATGACAAAAGG - Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935929752 2:108111746-108111768 CTAAATATGGAAAGGAAAAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936664957 2:114584377-114584399 ATAAATAAACAAATAAATAAAGG - Intronic
937174704 2:119917728-119917750 CAAAAAAAACAAAAGAAAAAAGG + Intronic
937416591 2:121719824-121719846 CAAAAAATAAAAATAAAAAAAGG - Intergenic
937664914 2:124475543-124475565 CAAAATATATAAACCAAAAATGG - Intronic
937668488 2:124514433-124514455 TAAAAAATACAAAAGAAAAAGGG - Intronic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937936053 2:127246256-127246278 ATAAATAAATAAATGAATAAAGG + Intergenic
938135914 2:128756362-128756384 CCAAAAATAGAGATGAAAAAAGG + Intergenic
938265382 2:129924325-129924347 CTAAAAATACAAAAAGAAAACGG + Intergenic
938285673 2:130113849-130113871 CCAAATCTTCAAATGAGAAAGGG - Intronic
938336317 2:130502416-130502438 CCAAATCTTCAAATGAGAAAGGG - Intronic
938353507 2:130618246-130618268 CCAAATCTTCAAATGAGAAAGGG + Intronic
938429932 2:131225051-131225073 CCAAATCTTCAAATGAGAAAGGG + Intronic
938474744 2:131598233-131598255 CCAAATCTTCAAATGAGAAAGGG + Intergenic
938484065 2:131685597-131685619 CTAGATATCCATATGCAAAAGGG - Intergenic
938694984 2:133826964-133826986 CTTTGGATACAAATGAAAAAGGG - Intergenic
938855960 2:135310952-135310974 CTCAAAATACAAAAAAAAAAAGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
938988366 2:136602182-136602204 ATAAATATAAAAAGAAAAAAAGG + Intergenic
939142051 2:138366060-138366082 TTAAATACACAAATGAAAAAAGG + Intergenic
939470527 2:142615021-142615043 CTAAATATGCAAAGAAAGAAAGG + Intergenic
939527210 2:143311284-143311306 CTAAATACAAAAAAAAAAAAGGG - Intronic
939533627 2:143396586-143396608 ATAAATATTCCAAAGAAAAAGGG + Intronic
939682442 2:145155263-145155285 CTAACTATAGAGATAAAAAAAGG + Intergenic
939746464 2:145976539-145976561 CAAAATAAAAAAAAGAAAAAAGG + Intergenic
939761317 2:146184173-146184195 TTTAGTATACAATTGAAAAAAGG + Intergenic
939935814 2:148292378-148292400 CTAACAATACAATTTAAAAATGG + Intronic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940186391 2:150988987-150989009 TTAAAAAAACAAATGAAAATGGG + Intergenic
940263021 2:151804088-151804110 CTCATGATATAAATGAAAAATGG + Intronic
940272124 2:151902481-151902503 CTAAACAACTAAATGAAAAAGGG + Intronic
940288183 2:152052814-152052836 CTAAAAATACAAAAAAAAATTGG + Intronic
940383198 2:153040203-153040225 CTAAAATTAGAAATGAAAGAAGG - Intergenic
940394408 2:153171739-153171761 CTAAATATAAAAACCTAAAATGG + Intergenic
941124010 2:161564212-161564234 CTAAATAAAAGAATTAAAAAAGG - Intronic
941184125 2:162299699-162299721 ATAATTATCCAAATGATAAATGG + Intronic
941185913 2:162321153-162321175 CAAAAAATATAGATGAAAAAAGG - Intronic
941435145 2:165461183-165461205 ATAAATTTACAACTGAAAACTGG + Intergenic
941479158 2:165984469-165984491 CAAAATATACACATGCATAATGG + Intergenic
941521034 2:166543368-166543390 ATAAATAAACAAAAGAAAGAGGG + Intergenic
941608871 2:167635618-167635640 CTAAGAATACAACTTAAAAAGGG + Intergenic
941729089 2:168896052-168896074 CTAAATATTAGTATGAAAAAAGG + Intronic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
941934080 2:170969827-170969849 ATATATATATAAATGACAAAAGG - Intergenic
941947516 2:171116018-171116040 ATAAATATAAAAATACAAAAAGG + Intronic
942388137 2:175463539-175463561 TTAAAAATACAAATAAAAGAAGG + Intergenic
942408261 2:175678757-175678779 CTAATTTTAGAAATGAGAAAGGG + Intergenic
942413192 2:175732981-175733003 CTGACTTTACAAATGAAGAAAGG + Intergenic
942581891 2:177428459-177428481 CTAAATATGAAAAAGAAAAATGG - Intronic
942979272 2:182059748-182059770 TTAAATATTTCAATGAAAAAAGG - Intronic
943070224 2:183132390-183132412 CTGAAAATACAAAAAAAAAAAGG + Intronic
943189629 2:184659306-184659328 TTAAACATACAAATGAATAGTGG - Intronic
943190741 2:184676886-184676908 CTAAAAATATAAATGTAAATAGG + Intronic
943204187 2:184870137-184870159 CTATATAAATAAATGTAAAAAGG + Intronic
943469758 2:188279020-188279042 CCAAATAAACAAATAAAAAAGGG - Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943847065 2:192664011-192664033 CTAAATATACTAGAGGAAAACGG - Intergenic
944079664 2:195772477-195772499 ATAAATATAAAAAACAAAAATGG - Intronic
944100568 2:196021821-196021843 AGAAAATTACAAATGAAAAAAGG + Intronic
944165236 2:196711765-196711787 CTAATTATACACATTCAAAAGGG + Intronic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
944199242 2:197087980-197088002 GGTAATATACAAATGACAAATGG + Intronic
944266839 2:197736737-197736759 TTGAATTTACAAATCAAAAAAGG - Intronic
944339638 2:198580948-198580970 CTATGTATAAAAATTAAAAATGG + Intergenic
944364960 2:198907497-198907519 CTTATTTTACAAATGAGAAATGG - Intergenic
945000924 2:205349554-205349576 CTAAATTTAAAAAATAAAAAAGG + Intronic
945140102 2:206676617-206676639 AAAAATATAAAAATGAAAAGGGG + Intronic
945501566 2:210581972-210581994 CTCAAGATACAGCTGAAAAAAGG + Intronic
945539295 2:211064284-211064306 CTAAATATACCAATTTCAAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945598649 2:211829830-211829852 CTATATTTACAAATTTAAAATGG + Intronic
945704734 2:213214815-213214837 CAAAATATATAAAGTAAAAATGG + Intergenic
945911177 2:215651417-215651439 CTAAATATATAAAGAAAGAAAGG + Intergenic
946502249 2:220261894-220261916 TTAAACATACACATGAAAATTGG - Intergenic
946782736 2:223207731-223207753 ATAAATATACAAATGAGAAAAGG + Intergenic
946815951 2:223578615-223578637 CTAAAAATAAAAATAAAAGAGGG + Intergenic
947332944 2:229049211-229049233 CTAATTTGACAGATGAAAAATGG + Intronic
947486975 2:230559486-230559508 GTAACAATACAAAGGAAAAAAGG - Intergenic
947785292 2:232813088-232813110 AAAAATATAAAAATGAGAAAAGG - Intronic
948084881 2:235239081-235239103 CTAAAAATATAAAAAAAAAATGG - Intergenic
949074822 2:242047898-242047920 CAAAATATGCAAAGTAAAAACGG + Intergenic
1169127759 20:3142298-3142320 CTAAAAATACAAAAAAAAATTGG + Intronic
1169369202 20:5015652-5015674 ATAAAAATAAAAATAAAAAACGG - Intergenic
1169472508 20:5900025-5900047 CTCAATTTAAAAATGACAAAAGG + Intergenic
1169797766 20:9483179-9483201 ATAAATGGATAAATGAAAAAGGG - Intergenic
1170295164 20:14816517-14816539 CAATTTATACAGATGAAAAATGG - Intronic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170769997 20:19324335-19324357 AAAAATATTCAAATCAAAAATGG - Intronic
1170912560 20:20588597-20588619 CAGAATATACAAATGTAAACTGG + Intronic
1171111623 20:22489504-22489526 ATAAATAAACAAATAAATAAAGG + Intergenic
1171274476 20:23844304-23844326 ATAAATAGACAGATGAGAAAAGG - Intergenic
1171936936 20:31283759-31283781 CTAAAATTAGAAATGAATAAGGG + Intergenic
1172058740 20:32174359-32174381 TTAACTATACAAATGGAAATAGG - Intergenic
1172400642 20:34648290-34648312 CAAAATATATAAAGCAAAAATGG - Intronic
1172527693 20:35610263-35610285 ATAAAAATAAAAATAAAAAATGG + Intergenic
1172563350 20:35908556-35908578 CTGAATTTACAAATAAAAACTGG + Intronic
1172638733 20:36427943-36427965 CAAAAAATAAAAATAAAAAAGGG + Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1172760960 20:37321407-37321429 CTAAATATGCAAATCAAAACCGG - Intergenic
1172802398 20:37585287-37585309 ATAAATCTAAAAATGAAATAGGG - Intergenic
1172893661 20:38284565-38284587 CTAAAAATAAAAATTAAAAGAGG + Intronic
1172974696 20:38897153-38897175 ATAAATAAATAAATGAAAAGTGG + Intronic
1173050197 20:39551952-39551974 ATAAATATACTGATGAAAAGGGG - Intergenic
1173695227 20:45004932-45004954 CTAAAAATACAAAAAAAAATTGG - Intronic
1173806975 20:45932582-45932604 CTAAAAATACAAATAAAATTAGG + Intergenic
1174245637 20:49177718-49177740 CTAAATATAAGAACGGAAAAAGG + Intronic
1174268052 20:49346172-49346194 CTAAATAAATAAATAAATAAAGG - Intergenic
1174311979 20:49663715-49663737 ATATATATATATATGAAAAATGG + Intronic
1174333856 20:49843527-49843549 GAAAATATTCATATGAAAAAGGG + Intronic
1174833631 20:53836358-53836380 CTAAAAATACAAAAGAAATTAGG + Intergenic
1174843280 20:53919555-53919577 CTAAATAAATAAATAAAGAAGGG + Intergenic
1174889580 20:54376380-54376402 CAAAACATAGAAAGGAAAAATGG - Intergenic
1174953035 20:55064266-55064288 CAAAATAAAAAAATGATAAAGGG - Intergenic
1174995496 20:55563074-55563096 CAACATATACAAATCAATAAAGG - Intergenic
1175017905 20:55811437-55811459 ATAAAACTAAAAATGAAAAAAGG - Intergenic
1175333828 20:58182170-58182192 CAAAATATAGAAAATAAAAAGGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175702058 20:61146752-61146774 ATAAATATATAAATAAATAAAGG - Intergenic
1176331774 21:5554829-5554851 CTAAATATAAAAAGCAAATATGG - Intergenic
1176395983 21:6266122-6266144 CTAAATATAAAAAGCAAATATGG + Intergenic
1176441174 21:6722982-6723004 CTAAATATAAAAAGCAAATATGG - Intergenic
1176465436 21:7050051-7050073 CTAAATATAAAAAGCAAATATGG - Intronic
1176488997 21:7431829-7431851 CTAAATATAAAAAGCAAATATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176948192 21:15010063-15010085 TTAAATAAATAAATGCAAAAAGG + Intronic
1176994807 21:15543190-15543212 CTAAATATATATTTGAACAAAGG - Intergenic
1177027147 21:15933961-15933983 CTAAAAATACAAGAAAAAAAAGG - Intergenic
1177073039 21:16534875-16534897 CTAAATAGAAAAAAAAAAAAAGG + Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177278729 21:18950680-18950702 CTCAATATAAAAATGAGAAAAGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177409087 21:20706815-20706837 CTAAAAATACAAAAAAAAATTGG + Intergenic
1177426088 21:20924099-20924121 CTAAATATGGAAAGGAAAAATGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178141080 21:29684308-29684330 CTAAATAGATATATGATAAACGG - Intronic
1178155333 21:29846866-29846888 ATACATATACATATGAAAACTGG - Intronic
1178194713 21:30330707-30330729 ATAAATATAGACTTGAAAAATGG + Intergenic
1178234783 21:30828879-30828901 ATCAATATAAAAATAAAAAATGG + Intergenic
1178281072 21:31283532-31283554 ATAAATAAATAAATAAAAAAGGG - Intronic
1178389992 21:32190326-32190348 CTACAGAGAAAAATGAAAAATGG + Intergenic
1178392135 21:32207424-32207446 ATAAATATAAAACTGAGAAAGGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178880382 21:36445385-36445407 CTAAAAATACAATAGAACAAAGG + Intergenic
1178997767 21:37420908-37420930 ATAAAAATACAAATGACAAAAGG - Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179074151 21:38102662-38102684 CTTAAATTACAAAGGAAAAATGG + Intronic
1179599935 21:42470669-42470691 ATAAAATTACAAATGAAAAGTGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180028471 21:45183593-45183615 CTAAAAATAAAAAGAAAAAAAGG - Intronic
1180566756 22:16675006-16675028 CAAAATATATACATGATAAACGG - Intergenic
1180904953 22:19403444-19403466 CTAAAAATACAAAAAAAAAGTGG + Intronic
1181101579 22:20544020-20544042 CTAAAGAAACAAAGGAAACAAGG - Intronic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
1181983165 22:26780896-26780918 TTGAATATAATAATGAAAAAAGG - Intergenic
1182017820 22:27055656-27055678 CAAAATAGACAAATAAATAAAGG + Intergenic
1182141477 22:27963222-27963244 CTGAATTTACAAATAAAAATAGG + Intergenic
1182156854 22:28082219-28082241 ATAAATATCCAAATTGAAAAGGG - Intronic
1182200278 22:28561237-28561259 CTAAAAATACAAAAAAAAATTGG - Intronic
1182553628 22:31116521-31116543 CTAAATAAATAAATAAATAAAGG + Intronic
1182603487 22:31485944-31485966 CTAAAAATACAAAAAAAAATAGG + Intronic
1182816640 22:33170381-33170403 ATAAATATAAAAATAAATAAAGG + Intronic
1183144647 22:35978762-35978784 AGAAATAAACAAATGAAAAAGGG + Intronic
1183612614 22:38920668-38920690 CAAATTCTACAAAAGAAAAATGG + Intergenic
1183807576 22:40224413-40224435 CCAACAATACAAAAGAAAAATGG - Intronic
1184055049 22:42041052-42041074 TTAAATATATAAATCAAATATGG - Intronic
1184102930 22:42350921-42350943 CTAAATAAATAAATAATAAACGG - Intergenic
1184440329 22:44508308-44508330 CTAAATCTAAAATTTAAAAAAGG - Intergenic
1185129381 22:49029371-49029393 CAAAATATACAATTAACAAAGGG - Intergenic
949175844 3:1061922-1061944 CTAAATATGGAAAGGAAAATTGG - Intergenic
949424595 3:3903286-3903308 CTAAATATAAGAATAAAAGATGG + Intronic
949455728 3:4236373-4236395 CTAAAAAGAAAAATGAGAAATGG + Intronic
949541837 3:5038696-5038718 TTAAACAAACAAACGAAAAATGG + Intergenic
949714029 3:6907241-6907263 ATAAAAATACAAAGTAAAAAGGG + Intronic
950036024 3:9886338-9886360 CTAAAAATATAAATAAAATAAGG + Intergenic
950282965 3:11722668-11722690 GTAAAAATACAAAAAAAAAATGG + Intergenic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950753734 3:15154652-15154674 ACAAAAATACAAATGAACAAGGG + Intergenic
950813813 3:15676913-15676935 ATAATTATAAAAATGATAAATGG - Intronic
950932172 3:16800976-16800998 TTAAATATGAAAATGAAAATTGG + Intergenic
951098581 3:18660087-18660109 CTAAAAAAAAAAATGATAAAAGG - Intergenic
951120920 3:18927780-18927802 ATAAATATACGCATTAAAAATGG + Intergenic
951365411 3:21775404-21775426 TTAAAAATAAAAATAAAAAAAGG + Intronic
951623804 3:24637301-24637323 CTAAATATATTAATTAAAACAGG - Intergenic
951714321 3:25622937-25622959 CTAAATATACAAAAAAAATTAGG - Intronic
951787916 3:26443287-26443309 GTAAATACACAAATGAGAAAAGG - Intergenic
952069246 3:29613654-29613676 ATAAATAATCAATTGAAAAATGG + Intronic
952212562 3:31243067-31243089 CTACATAAACGAATGAAGAATGG - Intergenic
952448409 3:33406629-33406651 CTAAATATCTAAAAGCAAAATGG - Intronic
952661097 3:35848733-35848755 ATAAATATGGTAATGAAAAAAGG - Intergenic
952898025 3:38092001-38092023 GTATATATACAAATGAAATCTGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953295991 3:41717452-41717474 GAAAATATACAAAAGAAAAGCGG - Intronic
953317021 3:41938265-41938287 CTAAATATACAATTGGTAAATGG + Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953663044 3:44904980-44905002 CTAAATAAATAAATAAATAAAGG - Intronic
953794313 3:45972291-45972313 CAAAAAATAAAAATAAAAAAAGG + Intronic
954281149 3:49578973-49578995 CTAAACAAATAAATGAATAAAGG - Intronic
954464127 3:50644790-50644812 CTAAATATATATGTGATAAAAGG + Intronic
954512955 3:51143677-51143699 ATAAACATTCAAATAAAAAATGG - Intronic
954822531 3:53343096-53343118 GTAGAGAAACAAATGAAAAACGG - Intronic
954890720 3:53925887-53925909 CTAAACATGGAAAGGAAAAACGG - Intergenic
955090513 3:55746030-55746052 CAAAATATTCAAATTAAGAAGGG - Intronic
955260695 3:57387407-57387429 TTATATATTAAAATGAAAAAAGG + Intronic
955393920 3:58542037-58542059 CTAAAAATACAAAAGATAACTGG - Intergenic
955628362 3:60945553-60945575 CTAAATATACAAAAAATAAGCGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956248204 3:67208009-67208031 TCAAATCTACAAATGAAAACTGG + Intergenic
956314206 3:67915947-67915969 CAAAAAATAAAAATAAAAAAAGG + Intergenic
956563412 3:70609428-70609450 ATAAATAAAGAAATAAAAAAGGG - Intergenic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
956619746 3:71210023-71210045 CAAAATATGGAAATGAGAAAAGG + Intronic
956801967 3:72767730-72767752 CTAAAAATAAGAATGAAAAAGGG + Intronic
956807446 3:72829505-72829527 ATAAATACATAAATGAAAGAAGG + Intronic
956890361 3:73607321-73607343 TTATATATACAAATAAAATATGG + Intronic
956965723 3:74457601-74457623 CAAAATAAACCAGTGAAAAAGGG + Intronic
957021284 3:75130745-75130767 ACAAATATACAATTAAAAAATGG + Intergenic
957430442 3:80098627-80098649 CACAATATATAAATGAACAAGGG + Intergenic
957704919 3:83768678-83768700 CTACATATGCAAAGGATAAATGG + Intergenic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
957863714 3:85994636-85994658 CTAAGTATTCAAATGAAAGGAGG - Intronic
957908016 3:86582662-86582684 CTAAAGATGGAAAGGAAAAACGG + Intergenic
957916936 3:86697526-86697548 CTAATTATCCAATTAAAAAATGG + Intergenic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958012306 3:87895301-87895323 TTAAATATACACAATAAAAATGG + Intergenic
958115235 3:89207954-89207976 TTAAATTTACAAATGAATAGGGG + Intronic
958261342 3:91384751-91384773 CTAAAAATACAGAGGAAAACAGG + Intergenic
958666691 3:97148748-97148770 TTAAATATAAAAATTGAAAATGG - Intronic
958683962 3:97368749-97368771 CTATATGTACAAATAATAAATGG - Intronic
958710022 3:97707040-97707062 CTAAATTTTCAATTTAAAAAGGG - Intronic
958966115 3:100560716-100560738 CGAAATATTCAAATAAAGAAAGG + Intronic
959175224 3:102900755-102900777 CTAAAGTCACAGATGAAAAAAGG - Intergenic
959269381 3:104187218-104187240 CTAAAAATAGAAATGCAATATGG - Intergenic
959394677 3:105822557-105822579 CTAAACAAACAAATCTAAAATGG + Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960038701 3:113127618-113127640 CTAAAAATACAAAAAAAAAAAGG - Intergenic
960059242 3:113302895-113302917 CAAAAAATAGAAATCAAAAATGG + Intronic
960276562 3:115736294-115736316 CTAAATATGGAAAGGAAAAACGG - Intergenic
960278379 3:115752879-115752901 CTAAATATGGAAAGGAAAAATGG + Intergenic
960300407 3:115996723-115996745 ATAAATAAAGAAATGAATAAAGG - Intronic
960413361 3:117355265-117355287 CTAATTTTAGAAATGAAAAAGGG + Intergenic
960660665 3:120054565-120054587 CAAAACATAAAAAAGAAAAAAGG - Intronic
960678398 3:120220937-120220959 GCCAATAAACAAATGAAAAAGGG - Intronic
960730205 3:120718956-120718978 CAAAGTATATAAATGAAAAATGG + Intronic
960753818 3:120985768-120985790 CTAAAGTCAGAAATGAAAAATGG - Intronic
960837815 3:121925599-121925621 CTCAATGAACAAATGACAAAGGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961544684 3:127624294-127624316 ATAAATAAATAAATAAAAAAAGG - Intergenic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
961845700 3:129761160-129761182 CTAAAAATACAAAAGAAAATTGG + Intronic
962010941 3:131390317-131390339 CTAAAAAAACAAAAAAAAAAGGG + Intergenic
962148538 3:132868209-132868231 TTATAGATACAAAAGAAAAAGGG + Intergenic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
962550894 3:136490200-136490222 CTAATAATACAAAAAAAAAAGGG - Intronic
962634534 3:137317086-137317108 CTCAATAAAAAAATGATAAAGGG - Intergenic
962792223 3:138821790-138821812 ATAAAAATAAAAATAAAAAAAGG + Intronic
962805320 3:138922993-138923015 AAAAATAAATAAATGAAAAAGGG - Intergenic
962899970 3:139753413-139753435 CAAAATAAACAAATAAATAAAGG + Intergenic
962938248 3:140101504-140101526 CAAAAGACACAAATGAACAAAGG - Intronic
963010447 3:140764865-140764887 TTATACATACAACTGAAAAAAGG - Intergenic
963089876 3:141473772-141473794 AAAAAAATACAAAAGAAAAAAGG - Intergenic
963195239 3:142520310-142520332 CTAAGTATACATATGAAAGGAGG + Intronic
963368811 3:144370935-144370957 CTAAACATATAAATGGAAGAAGG + Intergenic
963415306 3:144987633-144987655 ATAAATATATGAATGAAGAATGG - Intergenic
963629093 3:147711298-147711320 CTAAATATAGAAAGGAAAAATGG - Intergenic
964009606 3:151875584-151875606 GTAAATATTAAAATGTAAAAGGG + Intronic
964174721 3:153812862-153812884 CTAACAAAACAAAGGAAAAATGG + Intergenic
964188839 3:153979299-153979321 GTTAAGAAACAAATGAAAAATGG + Intergenic
964285601 3:155114431-155114453 CTATATAAACAAATGCAAATTGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964483764 3:157166027-157166049 CAACATATACAATTGAAACATGG - Intergenic
964629134 3:158790545-158790567 CTAAATACACAAATATAGAAGGG + Intronic
965011479 3:163098224-163098246 CAAAAAATAAAAATAAAAAAGGG - Intergenic
965025688 3:163298609-163298631 CTAAATATAGAAAGAAAAAATGG + Intergenic
965036083 3:163439816-163439838 ATAAAAATAAAAATAAAAAAAGG + Intergenic
965195858 3:165593295-165593317 CTTAATATAAAAATAAGAAATGG + Intergenic
965243919 3:166241572-166241594 CTAAGCATGCATATGAAAAAGGG + Intergenic
965250663 3:166340626-166340648 CTTTATATACTAATGATAAAAGG - Intergenic
965263538 3:166512486-166512508 CTAAATATGGAAAGGAAAACTGG + Intergenic
965268757 3:166585035-166585057 CTAAAGTTACAAGTGAACAAAGG - Intergenic
965272350 3:166634807-166634829 CTAAACATACGAAAGAAAAAGGG - Intergenic
965305213 3:167055952-167055974 ATAAACAAACAATTGAAAAATGG + Intergenic
965440067 3:168701192-168701214 TTAAAGATACAAAAGAGAAAGGG - Intergenic
965596557 3:170417019-170417041 CTTATTTTACAAATGAGAAAAGG + Intergenic
965620162 3:170634942-170634964 CTAAAGACAGAAATGAAAACAGG - Intronic
965653339 3:170956432-170956454 TTAAATTTACAAAAAAAAAAAGG - Intergenic
965795780 3:172437295-172437317 CAAAATATAGTAATAAAAAAAGG + Intergenic
965799140 3:172473778-172473800 TTATATATAAAAAAGAAAAAGGG + Intergenic
965907729 3:173729889-173729911 ATAGATATGCAAATGTAAAATGG - Intronic
966016317 3:175142194-175142216 TTAGATGCACAAATGAAAAATGG - Intronic
966052896 3:175642853-175642875 CAAAGTACACAAATGTAAAATGG + Intronic
966156041 3:176917723-176917745 CCAAATATACATTTGAAAAGAGG - Intergenic
966251721 3:177873619-177873641 CTATTTATTCAAATTAAAAATGG - Intergenic
966298355 3:178450314-178450336 CTAAATAAATAAATAAATAAAGG - Intronic
966488703 3:180501876-180501898 CTAAATATGGAAAGTAAAAATGG - Intergenic
966563607 3:181350903-181350925 CTAGATATATAAATGGAAAAGGG + Intergenic
966663382 3:182441662-182441684 CTAAACATGCAAAGAAAAAAAGG - Intergenic
966967381 3:185007967-185007989 TTAAATGGACAAATGAAAACAGG - Intronic
967004506 3:185371244-185371266 ACAATTATACAAATGAAGAAGGG - Intronic
967065474 3:185911491-185911513 CTAAACAAACAATTGGAAAAGGG - Intergenic
967081714 3:186055698-186055720 CTAAAGATTCAAATGGGAAAAGG - Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967532009 3:190559234-190559256 CTAAAAATAGAAATGAATGATGG - Intronic
967676236 3:192302007-192302029 GTAAATATTAAAATGAAATAGGG - Intronic
967738690 3:192981709-192981731 CTAAATATATAAAATACAAAAGG - Intergenic
967831303 3:193922341-193922363 GTAAATAGACAAATAAAAAAGGG - Intergenic
968339028 3:197939288-197939310 CTTGAAATACAAATAAAAAAAGG + Intronic
969151213 4:5170292-5170314 ATAAAAATAAAAATAAAAAAAGG - Intronic
969280625 4:6168284-6168306 CTAAATATGTAACTGAAAGATGG + Intronic
969831687 4:9802722-9802744 CTAAAAATACAAAACAAAATTGG - Intronic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970541473 4:17084638-17084660 CAAAATACCCTAATGAAAAATGG + Intergenic
970820611 4:20207431-20207453 CTAAGTATTCAACTGAAAATTGG + Intergenic
970941462 4:21639312-21639334 CTAATTACAGAACTGAAAAATGG + Intronic
971114192 4:23624693-23624715 CAAAATAAACATATGAAAATCGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971396442 4:26232055-26232077 CTAAAAATACAAAAAAAAATTGG - Intronic
971539800 4:27801631-27801653 TTAAATATAAAAATGAAAGATGG - Intergenic
971596159 4:28531628-28531650 ATAAATATACTAATGGCAAAAGG + Intergenic
971925158 4:32999351-32999373 GTGAGTATAAAAATGAAAAAAGG - Intergenic
971989817 4:33878027-33878049 CAACATATACAAATCAACAAAGG - Intergenic
972053229 4:34766966-34766988 CTAAAGAAAAAAATGAAAAAAGG - Intergenic
972145296 4:36017177-36017199 GTCAAGATAAAAATGAAAAATGG + Intronic
972187464 4:36548327-36548349 CTAAATATAAACATCAAAATTGG - Intergenic
972247291 4:37258847-37258869 CTAATTTTCCAAAAGAAAAATGG - Intronic
972495659 4:39631909-39631931 CTAAATTTAAAAAAAAAAAAAGG + Intronic
972606096 4:40615275-40615297 CAAAATATACAAAAAAAAATTGG + Intronic
972614389 4:40684233-40684255 TTAAATGTACAAATAACAAAGGG - Intergenic
972962483 4:44471250-44471272 TTAAATAAACAAGTTAAAAAAGG - Intergenic
973196515 4:47449085-47449107 CAAAAAATCCAATTGAAAAATGG + Intergenic
973296420 4:48527270-48527292 TTAAAGATAAAGATGAAAAATGG + Intronic
973313408 4:48733448-48733470 TTAAAAATAAAAATAAAAAAAGG + Intronic
974066053 4:57078483-57078505 CTAAAAAAAAAAAAGAAAAATGG + Intronic
974139290 4:57864090-57864112 CTTGGTATACATATGAAAAAAGG + Intergenic
974161475 4:58146821-58146843 CTAATAATAGAAATGAAAGAAGG + Intergenic
974207341 4:58723096-58723118 CTCAATACACAAAAGAAACAAGG + Intergenic
974225213 4:59033361-59033383 CTAATTATGCAATTTAAAAATGG - Intergenic
974391569 4:61277017-61277039 TTAAATAAACAAATGAAATAGGG - Intronic
974393683 4:61307229-61307251 ATTAATATAATAATGAAAAATGG + Intronic
974403701 4:61438329-61438351 ATAAAAATAAAAATAAAAAAAGG - Intronic
974408183 4:61503860-61503882 CAAAACAAAAAAATGAAAAATGG - Intronic
974592003 4:63963698-63963720 ATAAATATACAAATATAGAAAGG + Intergenic
974930349 4:68353998-68354020 ATAAAAATAAAAATAAAAAAAGG + Intergenic
975043544 4:69773883-69773905 ATAACTACAAAAATGAAAAATGG + Intronic
975044880 4:69790072-69790094 GTGAATATAAAAATAAAAAAAGG - Intergenic
975078688 4:70247304-70247326 CTATAAAAACAAATGAAAGATGG + Intronic
975167963 4:71199640-71199662 ATAAAAATAAAAATAAAAAAAGG - Intronic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
975276547 4:72507881-72507903 TTAAATATGCAAGTCAAAAAAGG - Intronic
975324070 4:73040366-73040388 CTTAAGATACATATGAAATATGG - Intergenic
975656291 4:76644146-76644168 CTATATATATAAAAGAAAAGAGG - Intronic
976161884 4:82210534-82210556 ATATATATACAAATAATAAACGG + Intergenic
976196781 4:82539759-82539781 TTAAATATACAGAATAAAAATGG + Intronic
976230209 4:82834778-82834800 CTAAATCTATAAAAGCAAAAAGG - Intronic
976335958 4:83886715-83886737 TTAAAAATAAAAATAAAAAAAGG - Intergenic
976514341 4:85947161-85947183 CCAAATAAACAATTAAAAAAGGG - Intronic
976686789 4:87822764-87822786 CTAAAGAGACGAATGAGAAATGG + Intronic
976780597 4:88754427-88754449 CTTACTATACAAAAGAAAACCGG + Intronic
977079041 4:92499774-92499796 CTAAATATACAAAAGTTAACTGG - Intronic
977095531 4:92738648-92738670 CTAAAAATAAAAAATAAAAAGGG - Intronic
977510485 4:97956014-97956036 ATAAAAATGCAAATGCAAAAAGG + Intronic
977630903 4:99241660-99241682 CTAATTATCCAATTTAAAAATGG - Intergenic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
978117627 4:105040230-105040252 CTAATCATCCAATTGAAAAATGG + Intergenic
978130567 4:105191198-105191220 CTGAAAATACAAAAGAAAGAGGG + Intronic
978185858 4:105856590-105856612 CTAAATATGGAAAGGAAAACTGG - Intronic
978298046 4:107232103-107232125 CTAAAAATCCAATTTAAAAATGG + Intronic
978325966 4:107555382-107555404 CCAAAAATTCAATTGAAAAATGG - Intergenic
978789798 4:112649481-112649503 CTAAATATAAAAAGTAAATAGGG - Intronic
978798606 4:112732916-112732938 CTAAAAATACAAAAAAAAAGGGG + Intergenic
979009471 4:115349235-115349257 ATAAACATGCAGATGAAAAAGGG + Intergenic
979039916 4:115776457-115776479 TTAAATATATAAAAGTAAAATGG - Intergenic
979248421 4:118535978-118536000 ATAAATAAATAAATAAAAAATGG + Intergenic
979828508 4:125270454-125270476 CTAAATAAACTAAAGAAAATTGG - Intergenic
980045448 4:127983185-127983207 CTAAAAAGACAAAAGTAAAAAGG - Intronic
980093849 4:128469400-128469422 CTAAAAAATAAAATGAAAAAAGG - Intergenic
980134107 4:128844041-128844063 CTAAAGGTTCAAAGGAAAAAAGG - Intronic
980225241 4:129975025-129975047 ATAAAAATATAAATTAAAAAAGG + Intergenic
980508111 4:133749174-133749196 TTAAATAAACAAATCAAAACAGG + Intergenic
980559529 4:134454721-134454743 ATAAATAAATGAATGAAAAATGG - Intergenic
980637296 4:135524260-135524282 CAAAATAATAAAATGAAAAAGGG + Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
980959878 4:139464277-139464299 CAAAAAATAAAAATAAAAAAGGG + Intronic
981036134 4:140170666-140170688 ATAAATTTACAAAGGTAAAAAGG - Intergenic
981117798 4:141012452-141012474 GTAAAAATTCACATGAAAAATGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981427019 4:144615249-144615271 CTAAAACTACAAAGGAAAAATGG - Intergenic
981643257 4:146969183-146969205 CAATATATACAAATGCCAAAGGG + Intergenic
981665414 4:147219632-147219654 CTGAACTTTCAAATGAAAAATGG + Intergenic
981764222 4:148229534-148229556 CTAAATAAACAAATGATATGTGG + Intronic
981770075 4:148299086-148299108 CAAAAAATAAAAATAAAAAACGG - Intronic
981878046 4:149572803-149572825 CTAAATTTGGAAGTGAAAAATGG - Intergenic
981885549 4:149668430-149668452 CTAAATATGGAAAGGAAAACTGG + Intergenic
982270432 4:153580512-153580534 CTAAATATACACAGGAACACTGG - Intronic
982332675 4:154198953-154198975 TTAAACATAGAAATGAAAAAAGG - Intergenic
982361058 4:154519633-154519655 ATATATATATAAAAGAAAAAAGG + Intergenic
982493596 4:156061900-156061922 ATAAATAAACAAATCAAACATGG + Intergenic
982540736 4:156667099-156667121 CAAAATATATAAAGGAAAAATGG - Intergenic
982687192 4:158505022-158505044 GAAAATATACATATGTAAAATGG + Intronic
983044294 4:162968005-162968027 CTAAATATGGAAAGGAAAACTGG - Intergenic
983089764 4:163489237-163489259 CAAAACATAAAAATGAAAAGGGG + Intergenic
983276619 4:165625367-165625389 CTAAATATAAAAATGAAATAGGG + Intergenic
983288592 4:165771426-165771448 ATAAATATAGTAAAGAAAAACGG + Intergenic
983423964 4:167558501-167558523 ATAAAAATAAAAATTAAAAAAGG - Intergenic
983477210 4:168228987-168229009 ATAAAAATAAAAATAAAAAATGG + Intronic
983512691 4:168626235-168626257 CTAAAAATACAAAAGAAATTAGG + Intronic
983602131 4:169542999-169543021 CTAAAAATAAAATTGACAAATGG - Intronic
983630733 4:169846653-169846675 TTAAATAAACAAATGAACTAAGG - Intergenic
983655432 4:170079106-170079128 ATAAATGTGCAAATTAAAAACGG + Intronic
983782729 4:171692234-171692256 ATAGATATACAAATAAATAAAGG + Intergenic
984141999 4:176014739-176014761 AGAAAAATAAAAATGAAAAAGGG + Intergenic
984142293 4:176018737-176018759 CTCAATATACAAAAGAATAGTGG - Intergenic
984151582 4:176139826-176139848 GTAAATATATAAGAGAAAAAAGG + Intronic
984287655 4:177753321-177753343 ATGAATAGAAAAATGAAAAATGG + Intronic
984394250 4:179174140-179174162 CTAAAATTAGAAATGAAAATTGG - Intergenic
984439110 4:179744040-179744062 CAATATATAGAAATGAAAATTGG + Intergenic
984641462 4:182168847-182168869 CAGAAGATATAAATGAAAAATGG - Intronic
984688325 4:182696825-182696847 CAAAATATAAAAATGAAATCAGG - Intronic
984828774 4:183951943-183951965 CTAAATAAATAAATAAAAAGTGG + Intronic
984981368 4:185285191-185285213 CTAATTTTTAAAATGAAAAATGG - Intronic
984991132 4:185382638-185382660 TTACAAATACAAATGCAAAATGG - Intronic
985082844 4:186283919-186283941 CAAAACATGCACATGAAAAATGG - Intronic
985170689 4:187146674-187146696 CTAGATTTCCAAAGGAAAAAGGG - Intergenic
985275039 4:188229871-188229893 ATAAAAATAAAAATGAAAAAGGG + Intergenic
985317994 4:188678890-188678912 ATAAATAAATAAATAAAAAATGG + Intergenic
985348212 4:189029809-189029831 CTTAAAATACAAATGATAAAGGG - Intergenic
985830832 5:2228257-2228279 AAAAATTTACAAATAAAAAAAGG + Intergenic
985951909 5:3228691-3228713 TTAAATACAAAACTGAAAAAAGG + Intergenic
985990245 5:3551497-3551519 CGAAATAAAAAAATGACAAATGG + Intergenic
986059631 5:4175743-4175765 CTATATAAACACATGAAACAGGG - Intergenic
986096890 5:4566038-4566060 ATAAATATCCACATCAAAAAAGG + Intergenic
986180443 5:5388200-5388222 CTAAATATACTAAAAAAAAAAGG + Intergenic
986261159 5:6147642-6147664 CAAAAAATAAAAATAAAAAAAGG - Intergenic
986411221 5:7481641-7481663 CTAATAATCCAATTGAAAAATGG - Intronic
986476358 5:8137743-8137765 TGAAATATACATATGAAAATTGG - Intergenic
986589219 5:9351586-9351608 CTCAATAAAATAATGAAAAATGG - Intronic
986604097 5:9504366-9504388 CTAAATACATTAATGAAAAGAGG - Intronic
986730696 5:10632768-10632790 ATAAAAATAAAAATAAAAAAGGG - Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986933163 5:12852583-12852605 ATAAATAAATAAATAAAAAAAGG + Intergenic
987291704 5:16514442-16514464 CTGAAGATACAAGTGAAACAAGG - Intronic
987422185 5:17733674-17733696 AGAAATATACAAATAATAAATGG + Intergenic
987460491 5:18203862-18203884 TTAAATAAATAAATGAAAATAGG - Intergenic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987798091 5:22655528-22655550 CAACATATACAAATGCAAAATGG - Intronic
987913322 5:24179167-24179189 CTAATAATACAATTTAAAAATGG - Intergenic
987943744 5:24576677-24576699 CTAAATAAATAAATGAACAGGGG + Intronic
987979547 5:25064122-25064144 TTATATATACAAATGAAAGTGGG + Intergenic
988065029 5:26221697-26221719 ATCAATATACAAATGCAAGAAGG + Intergenic
988152567 5:27405167-27405189 CCAAATACAGAAATGAAAGAAGG + Intergenic
988189632 5:27912527-27912549 CTAAATATATGAATTAAAACTGG - Intergenic
988337451 5:29924734-29924756 TTAGATATACAAATTAAATAAGG - Intergenic
988337497 5:29925611-29925633 CTAAAAATACAAATAAAAGCTGG - Intergenic
988387059 5:30577949-30577971 CTGCATATACTACTGAAAAAGGG - Intergenic
988516637 5:31910689-31910711 CTAAAAATACAAAAAAAAAAAGG - Intronic
988577511 5:32442065-32442087 CTACAGATAGAAATGAAGAAAGG - Intronic
988780412 5:34516069-34516091 CTAAATAAATAAATAAATAAAGG + Intergenic
989556333 5:42800181-42800203 TTAGATATACAAAAGATAAATGG + Exonic
989657218 5:43758210-43758232 CTAAATATGGAAAGGAAAAATGG - Intergenic
989803767 5:45579204-45579226 CAAAGTTTACAAATGACAAACGG + Intronic
989824060 5:45832839-45832861 ATAAAAATAAAAATAAAAAAAGG - Intergenic
989825528 5:45849772-45849794 CTAAATATGGAAAGGAAAAAGGG + Intergenic
989850357 5:46200968-46200990 CTAAATGTCCAATTGCAAAATGG + Intergenic
989852482 5:46231854-46231876 CCAAATATCCATAGGAAAAATGG - Intergenic
990023357 5:51155800-51155822 CAAAAAATAAAAATAAAAAAAGG + Intergenic
990092407 5:52069444-52069466 CAAAAAATCCAATTGAAAAATGG + Intronic
990128320 5:52547522-52547544 CTAAATATACCATTAAATAATGG - Intergenic
990327538 5:54693182-54693204 CAAAATATTCAATAGAAAAATGG + Intergenic
990570989 5:57078647-57078669 ATAAATAAATAAATAAAAAAGGG + Intergenic
990789246 5:59457727-59457749 GTAAAAATACAAAATAAAAATGG + Intronic
990811343 5:59727552-59727574 ATAAACAAACAAATAAAAAAGGG + Intronic
990854299 5:60246116-60246138 CTATATAAGAAAATGAAAAAAGG - Intronic
991025507 5:62025398-62025420 CTAAATATGGAAATGGAAACTGG - Intergenic
991217853 5:64176316-64176338 ATAAAATTAGAAATGAAAAAGGG - Intronic
991360502 5:65814717-65814739 CCAAAGATAAAAATAAAAAATGG + Intronic
991375315 5:65959317-65959339 CTCCATAGAAAAATGAAAAAAGG - Intronic
991393385 5:66174869-66174891 TCAAATATACAAAAGCAAAAGGG - Intronic
991446475 5:66705421-66705443 CAAAAGATATAAATGATAAAAGG + Intronic
991628545 5:68630501-68630523 ATGAATAAACAAAGGAAAAATGG + Intergenic
991692140 5:69235321-69235343 CGAAATGTAAAAATGCAAAAAGG + Intronic
992117640 5:73556492-73556514 TTAAATATTGAAATGTAAAAAGG + Intronic
992258179 5:74943030-74943052 CTAAATAAATAAATAAATAAAGG - Intergenic
992536068 5:77704992-77705014 CTACATACACAGATGTAAAAGGG - Intronic
992589953 5:78284646-78284668 ATATATATGCAAAAGAAAAAAGG + Intronic
992691833 5:79248189-79248211 CTAAAAATACAAAAGTTAAAAGG - Intronic
992943585 5:81787742-81787764 CCAAATAACAAAATGAAAAAGGG - Intergenic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993146341 5:84098191-84098213 CTGAACATATAAATGTAAAATGG + Intronic
993225014 5:85158330-85158352 CTAAATATCCTCATAAAAAAGGG + Intergenic
993290010 5:86054929-86054951 CTAAATATACCTATGGAAGATGG - Intergenic
993426169 5:87766678-87766700 CTAAAAATACAATTTAGAAAGGG - Intergenic
993481113 5:88425789-88425811 CAAAAAATAAAAATAAAAAAAGG - Intergenic
993505045 5:88698782-88698804 TAATATATACAAATGAAGAATGG - Intergenic
993511915 5:88781296-88781318 CTAAATTTACATATGCAAAAAGG + Intronic
993834298 5:92797760-92797782 CTAAATAAATGAATAAAAAACGG - Intergenic
993907666 5:93641459-93641481 ATAAATCTGCACATGAAAAAAGG + Intronic
994065668 5:95538624-95538646 TTAAAGTTACAAATAAAAAAAGG + Intronic
994175875 5:96710461-96710483 AGAAACATACAAAGGAAAAAGGG - Intronic
994357333 5:98808423-98808445 AAAAATAAACAAATGAGAAAGGG + Intergenic
994402181 5:99295143-99295165 TTAAATATATTAATGAAAAATGG + Intergenic
994436318 5:99737922-99737944 CTAATTAAAAAAAAGAAAAAAGG - Intergenic
994458188 5:100041303-100041325 ATACATATATTAATGAAAAAGGG + Intergenic
994509123 5:100681384-100681406 CTAAATATAAAATTGTTAAAAGG - Intergenic
994522785 5:100862561-100862583 CTAAAAATACAAAAAAAAAATGG - Intronic
994566874 5:101459927-101459949 CTCACTAGACAAATGAAAACTGG - Intergenic
994595840 5:101833602-101833624 CTCAAAATAAAAAAGAAAAAAGG - Intergenic
994622605 5:102180588-102180610 CCAAGAATACAAAAGAAAAAAGG + Intergenic
994897834 5:105727236-105727258 ATAAATACACAAATAATAAAAGG + Intergenic
994957372 5:106550486-106550508 ATAAAAATAAAAATGTAAAAAGG + Intergenic
995101364 5:108311157-108311179 ATAAAAATAAAAATAAAAAAAGG - Intronic
995186696 5:109279694-109279716 CTAAATATCCAATTTAAAAATGG + Intergenic
995264351 5:110140110-110140132 CAAAATATAGAAATGAATGACGG + Intergenic
995365101 5:111350612-111350634 CTAGATCTACAATAGAAAAACGG + Intronic
995850364 5:116538695-116538717 TTAAATATACAAATAATACATGG + Intronic
996444056 5:123524140-123524162 GTAAATATATAAATGCAAAGTGG + Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
996815257 5:127566956-127566978 CTAATTTTACAGATGAAAATGGG - Intergenic
996851969 5:127963243-127963265 CAAATTATACAAATACAAAATGG - Intergenic
997286580 5:132683634-132683656 CTAAAAATAAAAATGGAAGATGG + Intergenic
997300315 5:132798900-132798922 CTAAAAATACAAAGGATAATAGG - Intronic
997334080 5:133092200-133092222 CTAAAAATAACAATGAAAGAAGG - Intronic
997378266 5:133414564-133414586 CTAAAAATACAAGTGAAATCAGG - Intronic
997677103 5:135721031-135721053 ATAAAAATAAAAATAAAAAAGGG - Intergenic
997684638 5:135780077-135780099 CTTAATATACAGGGGAAAAAAGG + Intergenic
997931139 5:138072363-138072385 CAAAAAATACAATTTAAAAATGG - Intergenic
998077705 5:139249810-139249832 CAAAAAATAAAAATAAAAAAAGG + Intronic
998091643 5:139374459-139374481 CAAAAAAAACAAATGCAAAATGG + Intronic
998187914 5:139997147-139997169 CAAAATAAATAAATAAAAAATGG + Intronic
998494658 5:142577318-142577340 ATAAAACTTCAAATGAAAAATGG - Intergenic
998906023 5:146906298-146906320 ATAAATAAATAAATGGAAAATGG - Intronic
998993757 5:147848014-147848036 AAAAATATACAACTGAAACAGGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999123412 5:149227836-149227858 ATAAATAAACAAAAGAAACATGG - Intronic
999220519 5:149972745-149972767 CTAAACATGCTAATTAAAAATGG - Intronic
999221764 5:149985588-149985610 CTGAATATAAAAGTGAGAAAAGG + Exonic
999225405 5:150018845-150018867 TAAAAAATACAAAAGAAAAATGG + Intronic
999501715 5:152153300-152153322 ATAAATACATAAATGACAAATGG + Intergenic
999543908 5:152605683-152605705 CTAAATAACCCAATTAAAAATGG - Intergenic
999652315 5:153779551-153779573 ATAAATAAATAAATAAAAAATGG - Intronic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
999755678 5:154662740-154662762 CTAAATAAATAAATAAATAAGGG - Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
999940035 5:156532110-156532132 CAAAAAATAAAAATAAAAAAAGG + Intronic
999964590 5:156795854-156795876 CTAAAGAATCAAATGAAGAATGG + Intergenic
1000158958 5:158581382-158581404 ATACAACTACAAATGAAAAAGGG - Intergenic
1000294018 5:159897483-159897505 CTAAAAAAAAAAAAGAAAAAAGG + Intergenic
1000316134 5:160093591-160093613 CTAAATATGAAGATAAAAAACGG - Exonic
1000321032 5:160134388-160134410 CAAAAAATAAAAATGAAAAGAGG + Intergenic
1000549899 5:162648063-162648085 CTAAATGTTCAAGTGAAAGAAGG - Intergenic
1000759995 5:165210993-165211015 TTAAATATACGAATTGAAAATGG + Intergenic
1000897676 5:166875363-166875385 CTTACTATACAAGAGAAAAAAGG + Intergenic
1001186274 5:169576052-169576074 CTTGATATACAAATGAAGTATGG - Intergenic
1001693516 5:173651285-173651307 CAAAAAATACAAAAGATAAATGG - Intergenic
1002462409 5:179381128-179381150 ATAAAAATAAAAATAAAAAAAGG - Intergenic
1002585797 5:180246614-180246636 GTTAAAACACAAATGAAAAAGGG + Intronic
1002613780 5:180437711-180437733 CTAACAATACAAATGGAAAGTGG - Intergenic
1002670038 5:180859363-180859385 CAAAATGTACAAAGGAAAGATGG + Intronic
1002855255 6:1030955-1030977 CTAAATATACATATTTAATAAGG + Intergenic
1002870076 6:1158782-1158804 CTAAATACACAGTTGTAAAAGGG + Intergenic
1002901203 6:1410950-1410972 ATAAATAAATAAATAAAAAATGG + Intergenic
1003029160 6:2586527-2586549 CAAAAAATACAAAAGATAAATGG - Intergenic
1003371018 6:5526429-5526451 TTAAATATATGAATGATAAAAGG - Intronic
1003975767 6:11342960-11342982 CTAAATATGAAAAAGAAAGAGGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004450840 6:15744785-15744807 TAAAATATACAATTGAAAAAAGG + Intergenic
1004510650 6:16281669-16281691 CTAAAAATACAAAAAAAAAATGG - Intronic
1004784777 6:18955691-18955713 AAAAATATACAAATCATAAAAGG + Intergenic
1004958762 6:20760997-20761019 CAAAATACACATATGATAAAGGG + Intronic
1005001171 6:21243483-21243505 ATGAATAAATAAATGAAAAATGG + Intergenic
1005327161 6:24713647-24713669 GTAAATATATATATTAAAAAAGG + Intronic
1005553732 6:26952084-26952106 CTAGATAAACAAAGAAAAAAAGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005747325 6:28850197-28850219 ATAAATAAATAAAAGAAAAAAGG + Intergenic
1005909952 6:30300491-30300513 CTAACTAGACTAATAAAAAAAGG - Intergenic
1005925307 6:30439765-30439787 TTATATTTACAAATTAAAAAGGG - Intergenic
1006087475 6:31606663-31606685 CTAAAAATACAAAAAAATAATGG + Intergenic
1006244283 6:32716783-32716805 CTAAAGATACAACAGAAATAAGG - Intergenic
1006282291 6:33064051-33064073 CAAAATAAAGAAATAAAAAAGGG - Intergenic
1006661444 6:35648949-35648971 CAAAAAATAAAAATAAAAAAAGG + Intronic
1006867452 6:37220544-37220566 ATAAATCTACAAAAAAAAAAAGG - Intronic
1007051027 6:38829997-38830019 CTAAAATTAGGAATGAAAAAGGG - Intronic
1007757923 6:44112722-44112744 CTAAATAAATAAATAAAAAAGGG + Intergenic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008074887 6:47135059-47135081 CAAAATAGACACATGAAGAAGGG - Intergenic
1008107270 6:47452487-47452509 CTAAAGATAAAACTGGAAAAGGG - Intergenic
1008113822 6:47523502-47523524 GTAAAAATAAAAATAAAAAACGG + Intronic
1008464377 6:51814467-51814489 CACACTATACAAATGAGAAAAGG + Intronic
1008840365 6:55895521-55895543 CTAAATATACAAAGGAAATAAGG - Intergenic
1008855284 6:56078042-56078064 CTAAATATTCATATAAAAAATGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008952548 6:57176366-57176388 CAAAATATAGAAATGATATATGG + Intronic
1008993818 6:57635397-57635419 CTAAAAATACAGAGGAAAACAGG - Intronic
1009182426 6:60534481-60534503 CTAAAAATACAGAGGAAAACAGG - Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009522588 6:64702704-64702726 CTAAATAAACAAATGAGTAATGG - Intronic
1009649472 6:66455809-66455831 TTATATATGCAAATGTAAAATGG + Intergenic
1009904097 6:69847475-69847497 CTAACTATTCCAGTGAAAAACGG + Intergenic
1010093296 6:72009618-72009640 CTCAATAAAAAAATGATAAAGGG + Intronic
1010263511 6:73842909-73842931 CATAATATAAAAATCAAAAATGG - Intergenic
1010802174 6:80188792-80188814 ATAAAAATAAAAATAAAAAAAGG + Intronic
1010841908 6:80656614-80656636 CTACAGATAAAATTGAAAAAGGG + Intergenic
1010881256 6:81176183-81176205 CTAAATATAAAAAGTAAAAACGG - Intergenic
1011053965 6:83185787-83185809 ATAAATAAATAAATGAAAAAAGG + Intronic
1011270724 6:85577250-85577272 CTAAAAATAAAAATAAAAATTGG + Intronic
1011341154 6:86315364-86315386 ATCAATATTCAAATGAAAGAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011458778 6:87581216-87581238 CTAATTTTGCTAATGAAAAAGGG + Intronic
1011469211 6:87690809-87690831 CTAAAAATACAAAAGTTAAACGG + Intronic
1011529671 6:88307652-88307674 CTAACATTAGAAATGAAAAAGGG - Intergenic
1011581941 6:88878063-88878085 ATAAATAAACAAATGAAATTAGG - Intronic
1011606628 6:89112741-89112763 CTATATTAAAAAATGAAAAAAGG - Intronic
1011776578 6:90737879-90737901 CTAAATATGGAAAGGAAAACTGG - Intergenic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1011989430 6:93495036-93495058 TTAAATATATATATGAATAATGG + Intergenic
1012110397 6:95223494-95223516 CAAATTATATAAAAGAAAAAGGG - Intergenic
1012207187 6:96476242-96476264 CTAAATATGGAAAGGAACAATGG - Intergenic
1012357316 6:98331555-98331577 ATAAATATACAAATAAAAGATGG + Intergenic
1012369872 6:98490658-98490680 ATATATATATAAATGCAAAAAGG - Intergenic
1012380994 6:98619475-98619497 CTACATCTACAGATGAAGAAAGG + Intergenic
1012408736 6:98931426-98931448 TTCAATATAGAAATGTAAAATGG + Intronic
1012412849 6:98979351-98979373 CCAAATAGCAAAATGAAAAATGG - Intergenic
1012471538 6:99578038-99578060 CTATATAAACAAAGGAAATAAGG - Intergenic
1012742460 6:103035743-103035765 GTATATATACAAATGACCAAAGG - Intergenic
1012747740 6:103116345-103116367 TTAAAGAAACAAGTGAAAAAAGG - Intergenic
1012763973 6:103340574-103340596 ATAAATATACTAATGGAAACGGG + Intergenic
1012823349 6:104116844-104116866 GGAAAAATAGAAATGAAAAAAGG + Intergenic
1012857482 6:104519389-104519411 CTAAATTTAAAAATGAGACAAGG + Intergenic
1012884489 6:104830392-104830414 CAAAAAATGCAAATGAACAATGG + Intronic
1013023571 6:106245474-106245496 CTCAGTGAACAAATGAAAAATGG - Intronic
1013222040 6:108086395-108086417 CTAAGTATACAAATATAAATAGG - Intronic
1013232927 6:108173255-108173277 ATAAGTATGCAAATGCAAAATGG - Intronic
1013244373 6:108272951-108272973 CAAAAAATAAAAATAAAAAAAGG - Intergenic
1013281499 6:108641523-108641545 TTAAATATGCAAAAGAAAAATGG - Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013643828 6:112115867-112115889 CTAAATGTTCACATGAAAAATGG - Exonic
1013794581 6:113872428-113872450 GTAAAAATATAAATGAAATATGG - Intergenic
1013972989 6:116042588-116042610 CTAAATATGGACAGGAAAAACGG + Intronic
1013993186 6:116278375-116278397 CTGAATATCCAAAGGAAACAGGG + Exonic
1014058157 6:117040615-117040637 ATAAATAAATAAATAAAAAAGGG - Intergenic
1014062514 6:117089460-117089482 CTAAATATGCAAATACAATATGG + Intergenic
1014175736 6:118328989-118329011 CTAACTATATTAAGGAAAAAGGG + Intergenic
1014308731 6:119772002-119772024 ACACATATAGAAATGAAAAATGG - Intergenic
1014361735 6:120485397-120485419 CTAAATAAACATATGATGAATGG + Intergenic
1014599596 6:123393722-123393744 AAAAATATATAAATAAAAAAGGG + Intronic
1014667314 6:124255272-124255294 CCAAATATACAAGTGTGAAATGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014927972 6:127297573-127297595 CTAATCACACAAAGGAAAAAAGG - Intronic
1014939882 6:127425630-127425652 TTAAATGTACAAGTGATAAAAGG + Intergenic
1015014299 6:128392037-128392059 CCAAATAAATAATTGAAAAATGG + Intronic
1015041251 6:128722604-128722626 CTAAACATTCAACTGCAAAAGGG - Intergenic
1015222646 6:130822300-130822322 CATAATTTACAATTGAAAAATGG + Intergenic
1015267351 6:131301891-131301913 ATAAAAATAAAAATAAAAAAAGG + Intergenic
1015276945 6:131392504-131392526 CTCAATTTACCAATGAACAAAGG + Intergenic
1015337239 6:132053834-132053856 TTAAATATGGAAATGAAAATCGG - Intergenic
1015387177 6:132637122-132637144 CTAAATATGGAAAGGAAAAATGG + Intergenic
1015468974 6:133580927-133580949 CTAAAATCACAAATGAAAATAGG + Intergenic
1015516706 6:134089579-134089601 CTAAAAATACAAATAATAGATGG + Intergenic
1015672333 6:135704633-135704655 CTAAAAATACAAAAAAAAATTGG + Intergenic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1015858396 6:137649951-137649973 CTAAATGTACAGATAAGAAAAGG + Intergenic
1016128065 6:140430862-140430884 CTAATACCACAAATGAAAAAAGG - Intergenic
1016166989 6:140958289-140958311 CTAAATATCCAAAGGATAGAGGG + Intergenic
1016195379 6:141330234-141330256 CAAAATATGCTCATGAAAAAAGG - Intergenic
1016217647 6:141621997-141622019 ATAAATAAATAAATAAAAAAGGG + Intergenic
1016290236 6:142520654-142520676 TTAAAAATACATATGACAAAGGG - Intergenic
1016522119 6:144957619-144957641 CTAAATATAGAAAAGATACAGGG + Intergenic
1016542852 6:145185700-145185722 GAAGATATACAAATGGAAAATGG + Intergenic
1016548786 6:145254291-145254313 CTAAAACTAAAACTGAAAAAAGG + Intergenic
1016766656 6:147801852-147801874 CTAAATATCCATAGGGAAAAAGG + Intergenic
1016791791 6:148074158-148074180 CAAAAAATAGGAATGAAAAAAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017229650 6:152059474-152059496 TTAAAAATACATATGACAAATGG + Intronic
1017252897 6:152301093-152301115 CGAATCATACAAATGAGAAAAGG + Intronic
1017347046 6:153396305-153396327 ATAAATAAATAAAAGAAAAAAGG - Intergenic
1017679729 6:156851362-156851384 CTAAATATACAATTAAACATTGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018132574 6:160746891-160746913 GGAAATATACAAATAAAAAATGG - Intronic
1018189396 6:161295808-161295830 CTAAATATACACAAAAAAAAGGG + Intergenic
1018304175 6:162437099-162437121 ATAAATAAATAAATAAAAAAAGG + Intronic
1018311112 6:162509916-162509938 GTTAATATACAAAAGAAAATAGG + Intronic
1018352416 6:162974009-162974031 CTAACATTTCAAATGAAAAAGGG - Intronic
1018588949 6:165395025-165395047 CTAAATATTCCAATAAAAAAGGG - Intronic
1019029442 6:168997727-168997749 ATAAAAATAAAAATAAAAAAAGG - Intergenic
1019668733 7:2266680-2266702 ATAAAAATACAAAACAAAAAAGG - Intronic
1019945568 7:4326180-4326202 ATAAATAGACAAATAAAATATGG - Intergenic
1020422550 7:8025433-8025455 CTAAATATAAAAATGTTAGATGG + Intronic
1020463885 7:8454484-8454506 TCAAATTTACAAATGAACAAAGG - Intronic
1020566957 7:9809863-9809885 CAAAATATACAAATGCAATGAGG + Intergenic
1020787093 7:12587225-12587247 CTAAAAATAAAAAGGAATAAAGG + Intronic
1020978241 7:15034883-15034905 CACAATAAACAAATGAATAATGG + Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021191292 7:17622590-17622612 CTAACAATAAAAATGAAACAGGG + Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021311060 7:19097030-19097052 TTAAATATTAAAATGAAAACAGG + Intronic
1021438995 7:20656425-20656447 CAAAAAATAGAAATTAAAAATGG + Intronic
1021595194 7:22308199-22308221 CTAAATGTGCATCTGAAAAATGG + Intronic
1021626432 7:22597830-22597852 ATAAACACACAAATGCAAAAAGG - Intronic
1021892558 7:25200148-25200170 CAAAAAATAAAAATAAAAAAAGG - Intergenic
1021989514 7:26128593-26128615 CTAAAAATAAAAATAAAATAAGG + Intergenic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1022138875 7:27475006-27475028 ATAAATATACAAAGAAAAAAAGG + Intergenic
1022205839 7:28162828-28162850 CAAAATATGCAAGTGAAAAAAGG + Intronic
1022358918 7:29641202-29641224 CGAGATAAACAAAGGAAAAAGGG - Intergenic
1022405039 7:30081083-30081105 CTACCTATACAAATGCAAAATGG - Exonic
1022808206 7:33844083-33844105 CTAAAAATAGAAAGGAAAAGAGG + Intergenic
1022825674 7:34010436-34010458 CAAAATATAAGAATGGAAAATGG - Intronic
1023190440 7:37574886-37574908 CTAAAAAGACAAATGACCAATGG + Intergenic
1023318341 7:38965458-38965480 ATAATTAAACAAATGAAAAATGG - Intergenic
1023481638 7:40641448-40641470 CTAAATAAATAAATGACAAGAGG + Intronic
1023576990 7:41638890-41638912 CTCAGTATAAAAATGAACAATGG + Intergenic
1023665333 7:42517164-42517186 CTAACTATATAAATGAACAGTGG + Intergenic
1023711660 7:42999996-43000018 CTAAATATTCAAGTGAAAGGAGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024057725 7:45675000-45675022 CTAAATATACCAATTAAAAGAGG - Intronic
1024838864 7:53560043-53560065 CTTAATAGAAAAAGGAAAAAAGG - Intergenic
1025118679 7:56280519-56280541 CTACATATAAAAAGGAAAAGAGG - Intergenic
1025221081 7:57108379-57108401 CTATACACACAAAAGAAAAAAGG - Intergenic
1025565764 7:62432411-62432433 CTAAAAATACAAAAAAAAACTGG - Intergenic
1025733373 7:64126085-64126107 ATAAATAAACAAATAAATAAAGG - Intronic
1025772321 7:64523392-64523414 ATAGATATACAAAAGAAAATAGG + Intronic
1026048687 7:66926313-66926335 CAAAAAATCCAATTGAAAAATGG + Intronic
1026202619 7:68227610-68227632 CTACATATAAAAAGGAAAAGAGG - Intergenic
1026810081 7:73456459-73456481 CAAAAAATCCAATTGAAAAATGG + Intronic
1027048411 7:75006539-75006561 CAAAAGATGCAAATGGAAAAGGG - Intronic
1027482224 7:78712613-78712635 CAAAATATACAAAAGAGTAAAGG + Intronic
1027647957 7:80828319-80828341 ATAAATATATAAAGAAAAAAGGG - Intronic
1027742351 7:82025934-82025956 CTAAATATATAAAGCAAACATGG - Intronic
1027850611 7:83446804-83446826 CTCATTTAACAAATGAAAAAAGG - Intronic
1027887367 7:83926375-83926397 CCAAATTTAAAAATGAAGAAAGG - Intergenic
1027897135 7:84059838-84059860 CTAAATACACAAACAAAAAGTGG - Intronic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028111570 7:86948524-86948546 CTAAATATAAAAAGGGAAACAGG + Intronic
1028260273 7:88655834-88655856 CTATATTTACAAATGAAAAAAGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028452146 7:90997437-90997459 TTAAACAAACAAATGAAAGAAGG - Intronic
1028518246 7:91700889-91700911 CTAAATATGGAAAGGAAAACTGG + Intronic
1028618440 7:92797461-92797483 CTATATATACTAATGAAATTGGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028787692 7:94814718-94814740 CAAAACATACAAAATAAAAATGG + Intergenic
1028944821 7:96565674-96565696 CTAATTTTACTGATGAAAAAAGG + Intronic
1028980782 7:96965871-96965893 CTAAACATTCTAATGAAAAAAGG - Intergenic
1029141354 7:98412779-98412801 TTAAAAATACAAAAAAAAAAAGG - Intergenic
1029384597 7:100235109-100235131 TCAAATATGCAAATGGAAAAGGG + Intronic
1029902642 7:104058332-104058354 CCAATAATAGAAATGAAAAAGGG + Intergenic
1029910690 7:104144123-104144145 ATAAAAATAAAAATAAAAAAAGG + Intronic
1030461619 7:109844019-109844041 CAACAAATACAAATAAAAAAAGG - Intergenic
1030476597 7:110042295-110042317 GTAAATATTCAAATACAAAAAGG - Intergenic
1030512557 7:110501774-110501796 CTAGATGAACTAATGAAAAATGG - Intergenic
1030558066 7:111051647-111051669 CTAAAAAAACAAACAAAAAATGG + Intronic
1030821344 7:114095696-114095718 CTAAATATATAAATGAGCACAGG - Intronic
1030840025 7:114339483-114339505 CTAAACATACGAAAGAAAAAGGG - Intronic
1030891445 7:115003903-115003925 CTCATTTTACAGATGAAAAACGG - Intronic
1030946688 7:115731932-115731954 ATAAATAAACAATGGAAAAAGGG + Intergenic
1030969051 7:116031378-116031400 TTAAAAATACAAATGAAATTGGG - Intronic
1031209076 7:118798773-118798795 CTAAATATGCAAACAAACAATGG - Intergenic
1031267439 7:119599199-119599221 CAAAAGATACAATTGACAAATGG - Intergenic
1031444811 7:121839370-121839392 GTAAAAAGACAAATGACAAAAGG - Intergenic
1031457616 7:122002588-122002610 CTAAAAATATTAAAGAAAAAGGG + Intronic
1031537122 7:122948299-122948321 CAAAATATACAAAATAAATATGG + Intergenic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1031940444 7:127783153-127783175 CTACATACCCAAATGAAAAGGGG - Intronic
1032318663 7:130865044-130865066 TTAAAAATACAAAAAAAAAAAGG + Intergenic
1032405949 7:131655566-131655588 CCAAATGTACAAATGAATGAAGG - Intergenic
1032873514 7:136011916-136011938 CTAAATAAATAAATAAAAATGGG - Intergenic
1033119743 7:138657121-138657143 ATAAATAAACAAATAAGAAAAGG - Intronic
1033390504 7:140924036-140924058 CCAAATAGAAAAGTGAAAAAGGG + Intronic
1034294404 7:149959196-149959218 CTAATTATCCAAATTGAAAAGGG - Intergenic
1034458471 7:151185027-151185049 ATAAATAAATAAATAAAAAATGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034755128 7:153609732-153609754 CAAAAAATACCAATAAAAAAAGG + Intergenic
1035012802 7:155734492-155734514 CAAACTCTTCAAATGAAAAATGG - Intronic
1035816630 8:2548380-2548402 ATAAATAAATAAATAAAAAAAGG - Intergenic
1035852853 8:2938776-2938798 CTAAATCTGCAAATGAAACCAGG - Intronic
1035867407 8:3099913-3099935 TAAATGATACAAATGAAAAATGG - Intronic
1035915277 8:3613624-3613646 CAAAATATACAAACAAAAAATGG + Intronic
1035916426 8:3629359-3629381 CTAAATACACATATAAATAATGG - Intronic
1036063940 8:5357248-5357270 GTAAATATCCCAGTGAAAAACGG + Intergenic
1036089461 8:5649612-5649634 GTAGATATAAAAATGAATAAAGG + Intergenic
1036095028 8:5714277-5714299 CAAAATATAAAAATTGAAAATGG - Intergenic
1036422935 8:8614664-8614686 CTAAAGACACAATTGAACAATGG - Intergenic
1036461990 8:8961552-8961574 CTACATGTAAAAATGATAAAGGG + Intergenic
1036501075 8:9314306-9314328 CTACATATACATAAGATAAAAGG - Intergenic
1036820988 8:11939696-11939718 CTAAAAATACAAATATAAGATGG - Intergenic
1037050296 8:14364252-14364274 GTAAATATAGAAATAAAATAAGG - Intronic
1037174305 8:15929211-15929233 ATAAATAAATAAATGAAAGAAGG + Intergenic
1037303143 8:17474621-17474643 CTAAAATTAGAAATGAGAAAAGG - Intergenic
1037304203 8:17487981-17488003 CTAAGTATCCAAATTTAAAATGG - Intergenic
1037368901 8:18152302-18152324 CAAAAAATAAAAATAAAAAAGGG + Intergenic
1037452958 8:19035723-19035745 CAAAATATCCCAATGAAAACAGG + Intronic
1037903200 8:22700288-22700310 CTAAAAGTACAAAAAAAAAATGG - Intergenic
1038134324 8:24769272-24769294 CTGACTATCCAAATGAAAATGGG - Intergenic
1038374733 8:27028411-27028433 ATAAATAAATAAATGAATAAAGG - Intergenic
1038550415 8:28462963-28462985 CTAAATATACATGTAAGAAATGG - Intronic
1038674419 8:29610503-29610525 CTAAAAATACAAAAAAAAATCGG - Intergenic
1038765832 8:30426954-30426976 CTCAAAAAACAAAAGAAAAAGGG - Intronic
1038876523 8:31556969-31556991 CTAAATACAGAAATAAAAAGTGG + Intergenic
1038961356 8:32523866-32523888 CTAAATAAATAAATAAAAATAGG + Intronic
1039194579 8:35016589-35016611 TTAAATATGTAAAAGAAAAATGG + Intergenic
1039316237 8:36375600-36375622 TCAAATAAACAAATGCAAAATGG - Intergenic
1039343479 8:36676681-36676703 TTAAATATAGAAAAGAAAATTGG - Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039402539 8:37282518-37282540 CAAAATAAAAAAATGACAAAGGG + Intergenic
1039625929 8:39052932-39052954 CTAAGGATGGAAATGAAAAATGG - Intronic
1039713629 8:40085179-40085201 ATAAATAAACAAATAAGAAAAGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039940120 8:42083182-42083204 CTAAAATTAGAACTGAAAAAGGG - Intergenic
1040347322 8:46518381-46518403 CTGAATCTACAAATCACAAATGG - Intergenic
1040547866 8:48414491-48414513 CTAAAATTAGAAATGAAAATGGG + Intergenic
1040561279 8:48525277-48525299 CATAAAATACAAAGGAAAAAAGG - Intergenic
1040652239 8:49462269-49462291 CTCATTTTACAGATGAAAAATGG + Intergenic
1040730244 8:50436849-50436871 CTGCATATACAAAAGCAAAAAGG - Intronic
1040748509 8:50675796-50675818 CAAAATATGGAAAGGAAAAACGG - Intronic
1040810421 8:51446433-51446455 TCCAATATAAAAATGAAAAATGG - Intronic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1041041195 8:53847813-53847835 CAAAAAATACCAATTAAAAATGG - Intergenic
1041069609 8:54114040-54114062 CTAAATATATAAAAGACAATAGG - Intergenic
1041303944 8:56440519-56440541 CCAATTTTACAAATGAAGAAAGG - Intronic
1041307800 8:56481248-56481270 TTAAAAATAGAAGTGAAAAATGG - Intergenic
1041321670 8:56620188-56620210 CTAAATATAAGAATGGAACATGG + Intergenic
1041355769 8:56998048-56998070 CTATATATACAATAGAAAACTGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041532862 8:58891311-58891333 CTAAATAGGAAAAAGAAAAAAGG + Intronic
1041696026 8:60737150-60737172 GGAAATAGTCAAATGAAAAACGG - Intronic
1041763248 8:61389851-61389873 CAAGATATACAAATGACCAAAGG - Intronic
1041823024 8:62061530-62061552 TAAAATAAACAAATAAAAAAAGG - Intergenic
1041996447 8:64065694-64065716 CAAATAATACAAATTAAAAATGG + Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042079376 8:65034466-65034488 TTATATATTCAAATGAAATATGG + Intergenic
1042093696 8:65188564-65188586 CTAAATATATACATGTAACAGGG - Intergenic
1042119065 8:65464854-65464876 CAAAAAATACAATTTAAAAATGG - Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1042359347 8:67864839-67864861 CAAAATATCCAAAAGGAAAATGG + Intergenic
1042454398 8:68983801-68983823 ATATATATACAAATGGAAGAAGG + Intergenic
1042579263 8:70258327-70258349 CTGAAGCTACAAATGAAAATTGG - Intronic
1042796970 8:72675068-72675090 CTAAATGTAGAAATGACTAATGG + Intronic
1042932227 8:74024986-74025008 CAAAATATATAAAAGAAAGATGG - Intronic
1043054245 8:75417597-75417619 CTAAAGCTAAAAATGAAATAAGG + Intronic
1043293422 8:78633641-78633663 TTAAATATACATATATAAAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043445997 8:80319869-80319891 CTAAATAAATAAATAAAACAAGG + Intergenic
1043570107 8:81593461-81593483 CAAAAAGAACAAATGAAAAAGGG + Intergenic
1043650937 8:82591264-82591286 TAAGATATACAAATGAAAATGGG - Intergenic
1043681094 8:83025143-83025165 CTATAGAAACAAATTAAAAAAGG + Intergenic
1043681683 8:83035171-83035193 CAAAATATACAATTAATAAAAGG - Intergenic
1043770450 8:84192717-84192739 CTAAATATACAAAAAATAACTGG - Intronic
1043860818 8:85314727-85314749 ATTAATATACAAATAAAACAAGG - Intergenic
1043879094 8:85521311-85521333 ATAAATATGTAAATGTAAAATGG - Intergenic
1044035412 8:87297010-87297032 CTAAAAATACAAACAAAAATTGG + Intronic
1044173348 8:89084874-89084896 ATAAAAATAAAAATAAAAAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044300600 8:90578722-90578744 CTAAAAATACAAAGAAAAGAGGG - Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044847286 8:96394679-96394701 CAAGATATAAAAATGAAAAGTGG + Intergenic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045262619 8:100590056-100590078 CTACAGATTCAAAGGAAAAACGG - Intronic
1045677539 8:104624481-104624503 ATAAATAAATAAATAAAAAATGG + Intronic
1045730969 8:105240312-105240334 CTACATATACACATAAAAATTGG - Intronic
1045745392 8:105413405-105413427 CAAAATATACATATAAAAAAGGG - Intronic
1045757652 8:105563825-105563847 AGAAATATACAAATGATTAAAGG - Intronic
1045944012 8:107774657-107774679 ATAAATATACAAAGTAAAAAGGG + Intergenic
1045962551 8:107984949-107984971 CTAAATTCACAAATAATAAATGG - Intronic
1046177499 8:110597399-110597421 CAAAAGATACAAAAGAAAGAAGG + Intergenic
1046501538 8:115084277-115084299 ATACATATACAAATGAAACGTGG - Intergenic
1046558777 8:115811896-115811918 CTGATTAAAAAAATGAAAAAAGG + Intergenic
1046972165 8:120235162-120235184 CAAAAAATAAAAATGATAAAGGG - Intronic
1047021430 8:120778971-120778993 ATAAATAAACAAATGAATGATGG - Intronic
1047039798 8:120980272-120980294 CTCAATTGAAAAATGAAAAAAGG + Intergenic
1047101481 8:121680890-121680912 CTAAAAATAAAAATAAAAAAAGG + Intergenic
1047287983 8:123504748-123504770 CTAAAAAATCAAATGAATAAAGG + Intronic
1047662275 8:127050304-127050326 CTAAAGCTAAAAATGAGAAATGG + Intergenic
1047771636 8:128034596-128034618 CTAAACATACATGTGCAAAATGG + Intergenic
1047987779 8:130253628-130253650 ATAATTATACAAAATAAAAATGG - Intronic
1048088439 8:131210501-131210523 CAAACTATGCATATGAAAAAAGG - Intergenic
1048108704 8:131442458-131442480 CTAATTATACCACTGTAAAAAGG + Intergenic
1048155665 8:131947348-131947370 ATAAAAAGACAATTGAAAAAAGG - Intronic
1048231232 8:132644026-132644048 ATAATTATATAAATGAAAAGGGG + Intronic
1048644991 8:136410109-136410131 CTAAATATAGAAGCAAAAAAGGG - Intergenic
1048689540 8:136945425-136945447 CTTAATCTATTAATGAAAAATGG - Intergenic
1048928181 8:139289776-139289798 CTAAATAAATAAATAAATAAAGG - Intergenic
1049123470 8:140762686-140762708 ATAAATATACAAATAAAAACTGG + Intronic
1049127488 8:140804995-140805017 CTCAATCTACAAATGTGAAAGGG + Intronic
1050060581 9:1705225-1705247 TTACATATACAACTGTAAAATGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050538056 9:6646919-6646941 CTAAAAATAAAAATAAAAAATGG - Intergenic
1050555585 9:6787227-6787249 AAAAACAAACAAATGAAAAATGG - Intronic
1050769095 9:9174303-9174325 ATAAATAGATGAATGAAAAAAGG + Intronic
1050964712 9:11784324-11784346 CTAAATATACAGAATACAAAAGG - Intergenic
1050973110 9:11902221-11902243 CTATATATAAAAAAGAAATATGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051051438 9:12937023-12937045 CTAAATATAGATATTAATAAAGG - Intergenic
1051203707 9:14661812-14661834 TTAATTAAACAAATGAAAAGGGG + Intronic
1051216761 9:14806166-14806188 ATAAAAATTTAAATGAAAAATGG + Intronic
1051297116 9:15608617-15608639 CCAAAAATCCAAAAGAAAAAAGG - Intronic
1051511436 9:17882584-17882606 ATAAATAAACAAATAATAAAAGG + Intergenic
1051511519 9:17883860-17883882 CAAAATATAAAAATTAAAATGGG - Intergenic
1051649748 9:19310151-19310173 GATAATATACAAATTAAAAAAGG - Intronic
1051750146 9:20332853-20332875 CCAAAAATAAAAATAAAAAAAGG + Intergenic
1051797236 9:20886157-20886179 CTAAATATATGAAAGGAAAATGG - Intronic
1051801234 9:20936663-20936685 CTAAAAATACAAAAAAAACAGGG + Intronic
1051947239 9:22583574-22583596 CTAATTTAAAAAATGAAAAAAGG + Intergenic
1052051452 9:23852755-23852777 CAAAACATACAATTGTAAAAAGG - Intergenic
1052179826 9:25511003-25511025 CTAAATTTTGAAATGAAAAATGG - Intergenic
1052200494 9:25772748-25772770 ATAAATATAAACTTGAAAAAAGG + Intergenic
1052636176 9:31107611-31107633 ATAAATACACATATGTAAAATGG - Intergenic
1052693821 9:31850512-31850534 TTAAATTTTCAAATGAAAACTGG + Intergenic
1052750790 9:32487785-32487807 CTAAGTGAACAAATGAATAAAGG + Intronic
1052752953 9:32510591-32510613 CTAAATATGGAAAGGAAAACTGG + Intronic
1052875317 9:33556254-33556276 ATAAATAAATAAATGAAAATAGG - Intronic
1052927654 9:34030941-34030963 CTAAAAATAAAAATAAAATAAGG + Intronic
1052940740 9:34130204-34130226 CAAAAAATAAAAATAAAAAAAGG - Intergenic
1052992993 9:34532702-34532724 ATAAATAAATAAAAGAAAAAAGG - Intergenic
1053118746 9:35529076-35529098 CTAAATATCCAATGGAAAAATGG - Intronic
1053136717 9:35655447-35655469 ATAAATAAATAAATGAAATATGG - Intergenic
1053277224 9:36792325-36792347 CTAAAAATAAAAATGAAATTAGG + Intergenic
1053730382 9:41049514-41049536 TAAAATAAATAAATGAAAAATGG + Intergenic
1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG + Intergenic
1053860208 9:42378877-42378899 ATAAATATTCAAATGAATAGTGG + Intergenic
1053934946 9:43140916-43140938 CTATGAATCCAAATGAAAAATGG - Intergenic
1054690519 9:68318565-68318587 CTAAATATACAGCTTGAAAAAGG - Intergenic
1054698119 9:68382545-68382567 TAAAATAAATAAATGAAAAATGG - Intronic
1054865680 9:69998686-69998708 TTAAATTTACAAAAGAAAAGAGG + Intergenic
1054967647 9:71047863-71047885 CACAACAAACAAATGAAAAACGG + Intronic
1055228930 9:74037241-74037263 AGAAATATACAAATGAAAGTAGG - Intergenic
1055320281 9:75076909-75076931 TTAAATATAAAACTGGAAAAAGG + Intronic
1055402933 9:75943701-75943723 CTAAGTATATGCATGAAAAATGG - Intronic
1055635812 9:78277973-78277995 TTAACTATACAAATGTAAACAGG - Intronic
1055706335 9:79008896-79008918 ATAAATGTACAAAAGAAGAAAGG + Intergenic
1055752304 9:79520519-79520541 CAAAATATAACAAGGAAAAATGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055897003 9:81188763-81188785 TCAAATAAACATATGAAAAAAGG + Intergenic
1057020189 9:91691350-91691372 ATAAATATACAAATGGATTATGG - Intronic
1057202298 9:93148273-93148295 CTAAATAAATAAATAAATAAAGG - Intergenic
1057333308 9:94136876-94136898 ATAAATAAACACATGAAAATAGG + Intergenic
1057425683 9:94947542-94947564 CTGAATGTAAAAATGAAATATGG - Intronic
1057639995 9:96810232-96810254 CAAAATATATAAAGCAAAAATGG + Intergenic
1057753937 9:97815291-97815313 CTAAAATCACAAATGAAAGAAGG - Intergenic
1057894126 9:98893189-98893211 CCAAATATAAAAATGAAATTAGG - Intergenic
1058133739 9:101283835-101283857 CTAAATAGACAAAAGACAAATGG + Intronic
1058275937 9:103040921-103040943 ATAAATAGATAAATTAAAAAAGG + Intergenic
1058460638 9:105179219-105179241 CTAAATAAATAAATAAATAAAGG - Intergenic
1058481584 9:105401231-105401253 TTAAATATACAAATAAGCAAAGG - Intronic
1058847878 9:108979932-108979954 CTGAATTAACAAAGGAAAAATGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059748978 9:117230008-117230030 CAAAAAATAAAAATAAAAAAAGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1060905343 9:127299863-127299885 CTAAAAATACAAAAAAAAATTGG - Intronic
1061197460 9:129114996-129115018 CAAAAAATAAAAATAAAAAAAGG - Intronic
1061426769 9:130503873-130503895 CTAAATATATAAATGGGGAAAGG - Intergenic
1062263296 9:135674273-135674295 CTAAATATTTAACTTAAAAATGG + Intergenic
1062515892 9:136935514-136935536 CTAAAAATACAAAAAAAAAAAGG - Intronic
1062553851 9:137105014-137105036 CTAAAAATACAAAAAAATAACGG - Intronic
1203430325 Un_GL000195v1:85505-85527 CTAAATATAAAAAGCAAATATGG + Intergenic
1185574004 X:1155977-1155999 CTAAAAATACAAAAAAAAAATGG - Intergenic
1185574029 X:1156115-1156137 CTAAAGATACAAAAAAAAAATGG - Intergenic
1185574055 X:1156253-1156275 CTAAAAATACAAAAAAAAAATGG - Intergenic
1185658881 X:1710630-1710652 CCAAATATACCAATAAAAATTGG + Intergenic
1185671132 X:1811020-1811042 CTAAGGATAAAAATGGAAAATGG + Intergenic
1186253437 X:7694071-7694093 CAAAATATAGAAAAGAAAGAGGG + Intergenic
1186597205 X:10996191-10996213 CAAAATGTAGAAATGAGAAAGGG + Intergenic
1186713549 X:12226482-12226504 CTAAATATAAAAATCAAGATCGG + Intronic
1186764677 X:12758796-12758818 CAAAAGGAACAAATGAAAAAGGG + Intergenic
1186939032 X:14484277-14484299 CTAATGATGCAAATGGAAAATGG + Intergenic
1187359657 X:18613304-18613326 TTAAATCTACAATTAAAAAAAGG - Intronic
1187608098 X:20908421-20908443 TTCAATATAAAAATGAAAATTGG - Intergenic
1187658503 X:21510334-21510356 CCAAATATAGCCATGAAAAAAGG + Intronic
1187718493 X:22128055-22128077 CTAAATAAATAAATAAGAAAAGG - Intronic
1187777429 X:22777848-22777870 ATAAATGTACAAATAAAAAATGG - Intergenic
1188170164 X:26914592-26914614 GTAAATATGCAAGTGTAAAAGGG - Intergenic
1188170744 X:26921673-26921695 ATAAATATATAAATGGAACATGG - Intergenic
1188239389 X:27766737-27766759 CTAAATAAATAAATAAATAAGGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188312259 X:28631622-28631644 CTAAATAGTAAAATTAAAAATGG - Intronic
1188316843 X:28685322-28685344 CTAAATAGCTAAATGAAACATGG - Intronic
1188346540 X:29073437-29073459 CTAAATGTCTTAATGAAAAACGG - Intronic
1188475353 X:30586235-30586257 ATAAATAAACAAAAGAAAAAAGG + Intergenic
1188550119 X:31354485-31354507 CTAGATTTAAAAATGTAAAACGG + Intronic
1188672780 X:32900248-32900270 ATAAATACAAAAATGAAAATTGG + Intronic
1188831613 X:34905187-34905209 CCAAATAATCCAATGAAAAATGG + Intergenic
1189072458 X:37878100-37878122 CTAAATTTTTAAATGAAAGAAGG + Intronic
1189150393 X:38700411-38700433 CAAAAAATACAAAAAAAAAAGGG + Intergenic
1189438354 X:41012633-41012655 ATAAAAATAAAAATAAAAAAGGG - Intergenic
1189525497 X:41815796-41815818 ATTAAAATACAAATAAAAAAAGG + Intronic
1189630906 X:42952333-42952355 CTAAACATATAAATAAAAGAGGG + Intergenic
1189712239 X:43825375-43825397 ATAAATAAATAAATTAAAAATGG - Intronic
1189873764 X:45412600-45412622 CTAATAATCCAATTGAAAAATGG - Intergenic
1189972228 X:46429604-46429626 CAAAATATGAAAATGCAAAAAGG + Intergenic
1190111552 X:47592565-47592587 TTAAATATATAAATTAAATAAGG + Intronic
1190469771 X:50766718-50766740 TTGAATATATAAATGTAAAAAGG + Intronic
1190592286 X:52016481-52016503 CTAAATATATAAAGGAAATATGG + Intergenic
1190814575 X:53918120-53918142 CTAAATTCACAAATTAAAAGAGG - Intergenic
1191612134 X:63128404-63128426 CTGAATTTAGAAATGAAAGAGGG - Intergenic
1191624168 X:63250732-63250754 CTGAATTTAGAAATGAAAGAGGG + Intergenic
1191646791 X:63490013-63490035 ATTAATATACAAGTGCAAAAAGG + Intergenic
1191776162 X:64815756-64815778 CTAAATATGGAAAGGAAAACTGG + Intergenic
1191836827 X:65472208-65472230 CTCAATTTAAAAATGAATAAAGG - Intronic
1191991378 X:67040236-67040258 GTAGATATACAAAAGATAAAGGG - Intergenic
1191999550 X:67134177-67134199 GTAAATAAATAAATGAGAAAAGG + Intergenic
1192081548 X:68052725-68052747 CTACACATACAAATGTGAAATGG + Intronic
1192084595 X:68083743-68083765 CTAAGTATGCAAGTGAAAGAAGG - Intronic
1192100815 X:68262620-68262642 CTAAAAATACAAATAAAATTAGG + Intronic
1192289243 X:69774760-69774782 TTAAATATACAAATGTAATAGGG + Intronic
1192355256 X:70396906-70396928 CTAAAAATACAAAAGAAATTAGG + Intronic
1192480983 X:71485671-71485693 CCAAATCTAAAAATGAACAAAGG - Intronic
1192488328 X:71550634-71550656 CAAACTATACAACTGATAAAGGG - Intronic
1192540545 X:71967142-71967164 CTAATATTACAAATGAAAGAGGG - Intergenic
1192729575 X:73789706-73789728 CTAAATATGGAAAGGAAAAATGG - Intergenic
1192922921 X:75726395-75726417 CAAAATATACCAATTAAAAATGG - Intergenic
1192975741 X:76282585-76282607 CTTAATAGACTAATGCAAAAAGG - Intergenic
1193171566 X:78343146-78343168 CTAAATATGGAAAAGAAAGATGG + Intergenic
1193177949 X:78417004-78417026 CTAAAATCACAAATGAAAGAGGG + Intergenic
1193217633 X:78883295-78883317 CTAAATATGGAAAAGAAAACTGG - Intergenic
1193251412 X:79295594-79295616 CTCAATAGACAAAGAAAAAAAGG + Intergenic
1193263161 X:79434123-79434145 CTAAAAAAACTAATCAAAAAAGG - Intergenic
1193652746 X:84158447-84158469 TTAAATATATAAAGGAAATAAGG + Intronic
1193698018 X:84732787-84732809 CTAAAAATAGAAATGAAAATGGG - Intergenic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1193782230 X:85717789-85717811 CTAAATATGGAAAGGAAAACTGG - Intergenic
1193991249 X:88310365-88310387 CTAAATATGGAAAGGAAAAACGG + Intergenic
1194045283 X:88994004-88994026 CTAAAAATCCAGATGTAAAAGGG + Intergenic
1194091977 X:89589020-89589042 CTGATTATATAAATGAGAAAAGG + Intergenic
1194334044 X:92623315-92623337 CAAAATGTACCATTGAAAAAGGG - Intergenic
1194373424 X:93102845-93102867 CTAACTATACAAATAATAAAAGG - Intergenic
1194439923 X:93919858-93919880 CTAAATATGTGAATGAATAATGG + Intergenic
1194483020 X:94450530-94450552 CTAATTAAACAAATCAGAAAGGG + Intergenic
1194524206 X:94957742-94957764 CTCAATATAGAAGAGAAAAAAGG + Intergenic
1194583961 X:95710536-95710558 ATAAATATTGAAATAAAAAATGG + Intergenic
1194636857 X:96355819-96355841 CTAAATAAAAAAATGATAAATGG + Intergenic
1194679109 X:96830006-96830028 CCAAATATATATATAAAAAAAGG + Intronic
1195262827 X:103150377-103150399 AAAAATAAAAAAATGAAAAAGGG + Intergenic
1195266058 X:103181043-103181065 GGAAATATAGAAATAAAAAATGG - Intergenic
1195293546 X:103452556-103452578 CTAAATAAAAAAATTATAAATGG - Intergenic
1195499232 X:105575180-105575202 TTAAAAATAAAAATTAAAAAAGG - Intronic
1195626940 X:107013632-107013654 CAAAAGATACAAAAAAAAAAAGG + Intergenic
1195984227 X:110611855-110611877 ATAAATAAATAAATGATAAAGGG + Intergenic
1196019127 X:110971479-110971501 CTAAATATTCAACTGATGAATGG - Intronic
1196064086 X:111443579-111443601 CAAAATAGACAAATGAAAGCAGG - Intergenic
1196118242 X:112020229-112020251 AAAAATATACATCTGAAAAATGG - Intronic
1196130452 X:112149830-112149852 CTAAAAAGAAAAATGAAACAAGG + Intergenic
1196159734 X:112469687-112469709 CTTAATAAACAAATGTAAGATGG + Intergenic
1196170523 X:112583105-112583127 CTACATTTAAAAAAGAAAAAAGG + Intergenic
1196201393 X:112889701-112889723 CTCAAAATCCAAATTAAAAATGG + Intergenic
1196697484 X:118628897-118628919 CTCAATTTACAAATGAAAATTGG + Intronic
1196823000 X:119718343-119718365 CCATATATAAAAATGAAAATGGG + Intergenic
1197574245 X:128189653-128189675 ACAAAAATACAAATAAAAAAAGG + Intergenic
1197582158 X:128296749-128296771 CTAGATATTCATATGCAAAAGGG + Intergenic
1197582160 X:128296777-128296799 CTAGATATTCATATGCAAAAGGG + Intergenic
1197587513 X:128367085-128367107 CTAAAAATACCAAGGAAACAAGG + Intergenic
1197587961 X:128373206-128373228 CTAAATATACCAAGGAAACAAGG - Intergenic
1197805930 X:130398647-130398669 ATAAAAATAAAAATAAAAAAAGG + Intergenic
1197859379 X:130953322-130953344 CTAAAAATACAATTTATAAAAGG - Intergenic
1197928289 X:131670088-131670110 TAAAATAAACAAATAAAAAAAGG + Intergenic
1198234283 X:134721870-134721892 ATAAAAATAAAAATAAAAAAAGG + Intronic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198621416 X:138515422-138515444 CTACATAAACAAATTAGAAAAGG + Intergenic
1199029915 X:142985478-142985500 CTTAAAATAAAAGTGAAAAAAGG - Intergenic
1199517610 X:148695602-148695624 ATAAACATAAAAAAGAAAAAAGG + Intronic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1200336459 X:155355700-155355722 CTAAATGTAGAAAGGAAAGATGG + Intergenic
1200350011 X:155485527-155485549 CTAAATGTAGAAAGGAAAGATGG - Intergenic
1200422566 Y:2987145-2987167 CTGAAGTTACAAATGAAAGAAGG - Intergenic
1200444613 Y:3245083-3245105 CTGATTATATAAATGAGAAAAGG + Intergenic
1200501779 Y:3958758-3958780 CTAAATATAACAAAGAAACAAGG - Intergenic
1200579148 Y:4926983-4927005 CTAAAAATACAAAAAAAAATTGG - Intergenic
1200642726 Y:5742309-5742331 CAAAATGTACCATTGAAAAAGGG - Intergenic
1200681454 Y:6216885-6216907 CTAACGATACAAATAATAAAAGG - Intergenic
1200898156 Y:8398092-8398114 CAAAATATACATATGACACAGGG - Intergenic
1201049806 Y:9921310-9921332 TTTAATATTCAAATGAATAAAGG - Intergenic
1201051060 Y:9935855-9935877 CTAAAAATACAAGAAAAAAATGG + Intergenic
1201055260 Y:9982593-9982615 CTATATATAAAAAATAAAAAAGG + Intergenic
1201282239 Y:12352176-12352198 CAAAACATACAAACAAAAAAAGG + Intergenic
1201300094 Y:12497827-12497849 CTAAAAATACAAAAAAAAATTGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201364874 Y:13193137-13193159 CTAAAATTAGAAATGAAAAAGGG - Intergenic
1201390451 Y:13491524-13491546 ATAATTAGACAATTGAAAAAAGG - Intergenic
1201395454 Y:13543017-13543039 ATAAATACAGAAATGATAAAGGG + Intergenic
1201470276 Y:14325701-14325723 CAAAATATAGAAAAGAAAGAGGG + Intergenic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic
1201922377 Y:19247250-19247272 CTAAATATGGAAAGGAAAACAGG + Intergenic
1201977164 Y:19864312-19864334 CTTTAAAAACAAATGAAAAAAGG - Intergenic
1202201624 Y:22357070-22357092 CTAAATATGTAATTGAAAAGGGG - Intronic
1202278634 Y:23152536-23152558 CTATATCCACAAATGAAGAAGGG + Intronic
1202286104 Y:23249073-23249095 CTATATCCACAAATGAAGAAGGG - Intronic
1202286569 Y:23256228-23256250 CTATATCCACAAATGAAGAAGGG - Intronic
1202431458 Y:24783876-24783898 CTATATCCACAAATGAAGAAGGG + Intronic
1202431761 Y:24788633-24788655 CTATATCCACAAATGAAGAAGGG + Intronic
1202432064 Y:24793389-24793411 CTATATCCACAAATGAAGAAGGG + Intronic
1202438204 Y:24869529-24869551 CTATATCCACAAATGAAGAAGGG - Intronic
1202438507 Y:24874286-24874308 CTATATCCACAAATGAAGAAGGG - Intronic