ID: 1028271593

View in Genome Browser
Species Human (GRCh38)
Location 7:88797530-88797552
Sequence GGATTAAACCAGAGAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028271588_1028271593 23 Left 1028271588 7:88797484-88797506 CCACATCCAGAGTGACTTCTGGT 0: 1
1: 0
2: 0
3: 14
4: 182
Right 1028271593 7:88797530-88797552 GGATTAAACCAGAGAGAACATGG 0: 1
1: 1
2: 0
3: 25
4: 260
1028271591_1028271593 -8 Left 1028271591 7:88797515-88797537 CCAATTTCCAGTCATGGATTAAA 0: 1
1: 0
2: 1
3: 16
4: 219
Right 1028271593 7:88797530-88797552 GGATTAAACCAGAGAGAACATGG 0: 1
1: 1
2: 0
3: 25
4: 260
1028271589_1028271593 17 Left 1028271589 7:88797490-88797512 CCAGAGTGACTTCTGGTATTTAT 0: 1
1: 0
2: 0
3: 16
4: 173
Right 1028271593 7:88797530-88797552 GGATTAAACCAGAGAGAACATGG 0: 1
1: 1
2: 0
3: 25
4: 260
1028271586_1028271593 29 Left 1028271586 7:88797478-88797500 CCTTCACCACATCCAGAGTGACT 0: 1
1: 0
2: 0
3: 19
4: 180
Right 1028271593 7:88797530-88797552 GGATTAAACCAGAGAGAACATGG 0: 1
1: 1
2: 0
3: 25
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028271593 Original CRISPR GGATTAAACCAGAGAGAACA TGG Intronic
900070400 1:767533-767555 AGATAAAAGCAGAGACAACAGGG + Intergenic
903517529 1:23921909-23921931 AGGTTAAAGCAGAGGGAACATGG - Intergenic
904486057 1:30825087-30825109 GGATTAAAATAGAGGGAGCACGG + Intergenic
904926979 1:34057210-34057232 GGAATCAAGCAGAGAGACCAGGG - Intronic
906635848 1:47409985-47410007 GGATTACACCAGGCAGATCAGGG + Intergenic
909275808 1:73685128-73685150 AGATTCAATCAGAGAGAACTTGG + Intergenic
909372815 1:74905281-74905303 GAAATAAACCAGAGACAAAAGGG - Intergenic
910354701 1:86341448-86341470 CAGTTAAACCAGAGAGAAAAAGG - Intergenic
910747099 1:90585915-90585937 GAATTAAAGCACAGTGAACAAGG + Intergenic
911582219 1:99646885-99646907 GCATTAAACAAGAGAAAACTAGG + Intronic
911711917 1:101083429-101083451 GGATTATCGCAGAGAGAAAAAGG - Intergenic
913128377 1:115814494-115814516 GGACTAAACCACTGAGACCATGG + Intergenic
913358019 1:117945388-117945410 GGATTCAGGCAGAAAGAACAGGG - Intronic
916601317 1:166296306-166296328 GGCTTAAAACAGAGACAAAAGGG + Intergenic
918355545 1:183704063-183704085 GGATTAAAGAGGAGAGAACAAGG + Intronic
920959541 1:210652176-210652198 GGATTGGAAGAGAGAGAACAGGG + Intronic
922137875 1:222850331-222850353 GGGTTTAAAAAGAGAGAACAAGG - Intergenic
924580655 1:245321133-245321155 GGATGAATAGAGAGAGAACAGGG - Intronic
1063922866 10:10949227-10949249 GGATGAAAGGAGAGAGAATATGG - Intergenic
1064142451 10:12802046-12802068 GGATTAAAACAGAGAGTTCTGGG + Intronic
1064534891 10:16348701-16348723 AGATTAGACCAGAGACACCAAGG + Intergenic
1065310054 10:24407045-24407067 GGAATAAGCCAGAGAGACCCTGG + Intronic
1066582391 10:36895298-36895320 GGATGAAACCAAATTGAACATGG + Intergenic
1067315053 10:45153288-45153310 AGATAAAAACAGAGACAACAGGG - Intergenic
1068758317 10:60680208-60680230 GGCTTAAAGCAGGGAGACCAAGG - Intronic
1068931106 10:62591450-62591472 GGATTACACCTGAGTGTACATGG - Intronic
1070158087 10:73848644-73848666 GGATTTAACGAGAGAGAAAGTGG - Intronic
1070963839 10:80517559-80517581 GGGTTAAACCAAAAATAACAGGG - Intronic
1071741774 10:88366752-88366774 GGATTAAAGCAGAGGGGACTTGG - Intronic
1073805550 10:107093803-107093825 GGATGAGGCCAGAGAGATCATGG - Intronic
1073835371 10:107435276-107435298 GGATTCAGGCACAGAGAACAAGG - Intergenic
1074079565 10:110156906-110156928 GGATTTAACCAGAAAGAAAAAGG - Intergenic
1077642236 11:3892241-3892263 GGAAGAAAACAGAGAAAACATGG + Intronic
1079691411 11:23422592-23422614 GGAATAATCGAGAGAGAACAGGG + Intergenic
1079995475 11:27290999-27291021 AGATGAAAGCTGAGAGAACAGGG + Intergenic
1080737800 11:35034060-35034082 GGATTAAATGGGAGAAAACATGG - Intergenic
1080863596 11:36173029-36173051 AGATTAAACCAGGAAGAAAAAGG - Intronic
1081481982 11:43497961-43497983 GGCAGAAACCAGAGAGAAGAGGG - Intergenic
1081776011 11:45676366-45676388 GAATAAAAGCAGACAGAACATGG + Intergenic
1082801341 11:57417062-57417084 GGATGAAATCAGAGAGCACATGG + Intronic
1083050021 11:59768756-59768778 GGATTGGACCAGAGAGATAATGG + Intronic
1083458861 11:62797738-62797760 AGTTTAAACCAGAGAGAAAAAGG + Intronic
1083670912 11:64299555-64299577 GGATTATCCCAGCGAGAACCTGG + Exonic
1085315439 11:75542125-75542147 GGAATCAATCAGAGAGAGCAGGG - Intergenic
1085315449 11:75542179-75542201 GGAATCAATCAGAGAGAGCAGGG - Intergenic
1087039652 11:93785918-93785940 GGATTCAGCCAGTGAGATCAAGG + Intronic
1087334528 11:96826462-96826484 GGATTAATCCAGAAAGGTCAAGG - Intergenic
1088529666 11:110794667-110794689 GGATAAAATGAGAGAGCACATGG + Intergenic
1088631812 11:111780703-111780725 GGATTAGACCATAGAAAATATGG - Intergenic
1089317755 11:117603773-117603795 GGATAAAAGCAGAAAGAAAAAGG + Intronic
1089546112 11:119226934-119226956 AGATTAAAGCATAGTGAACAAGG - Intronic
1090315972 11:125788781-125788803 GGATGCAACTTGAGAGAACATGG + Intronic
1094214123 12:27922669-27922691 GTATTAAACCAGAGCTATCAAGG + Intergenic
1094825070 12:34263608-34263630 GGATTAAAAAAGAAAGAAAAAGG - Intergenic
1096743696 12:53712306-53712328 GGACTAAAGAAGAGAGGACATGG - Intronic
1097391809 12:59024355-59024377 GGTTTAAACCAGAGAGAACAAGG - Intergenic
1098489004 12:71053264-71053286 GAATTAATCCACAGAGAATAAGG - Intronic
1098598578 12:72302155-72302177 GGAAGAAACCAGAGAGAGAAAGG + Intronic
1098652946 12:72996645-72996667 GGCTAAAACCTGAGAGAAAATGG - Intergenic
1099861912 12:88232406-88232428 GGAGTAAAGAGGAGAGAACAAGG - Intergenic
1100572884 12:95859281-95859303 GGATTCAAACAAAGAGAAGAAGG - Intronic
1100590667 12:96025300-96025322 GTGTTAAACCAGAGAGAAATGGG - Intronic
1101593799 12:106145703-106145725 GGTTTAGAACAGAGAAAACAAGG - Intergenic
1101787314 12:107895650-107895672 GGATAAAAGCAGGCAGAACATGG - Intergenic
1102452596 12:113053016-113053038 TGATTAAATCAGAGGAAACAGGG - Intergenic
1102559915 12:113754650-113754672 GGATGGAAGCAGAGAGACCAGGG + Intergenic
1102733189 12:115132764-115132786 TGATTAAAGCAGACAGAACTTGG - Intergenic
1102736367 12:115164143-115164165 GAATTAACCCAGAGAAAACCTGG - Intergenic
1102800810 12:115731961-115731983 GGATCAAACCAGATAGTATATGG - Intergenic
1102995619 12:117347766-117347788 GATTTAACCCAGGGAGAACAAGG - Intronic
1104266376 12:127236970-127236992 GGATTAAACTGGACAGAACGGGG + Intergenic
1106396339 13:29384608-29384630 GGAACAAACCACACAGAACACGG - Intronic
1106700318 13:32222017-32222039 GGACTAAAGCAGAGCGAGCAGGG + Intronic
1109304907 13:60627504-60627526 GGATTAGACAAAAGAGAAGATGG - Intergenic
1114236951 14:20832277-20832299 GGAGTAAAGAGGAGAGAACAAGG + Intergenic
1116745284 14:48810207-48810229 GGATAAGACCAGAGAGTGCAGGG + Intergenic
1116779505 14:49220853-49220875 TGAGTAAAACAGAGAGAATAAGG + Intergenic
1117204895 14:53431794-53431816 GGATAAAACCAGCAAGTACATGG + Intergenic
1118093971 14:62515883-62515905 GGATGACTCCAAAGAGAACATGG + Intergenic
1118899961 14:69978282-69978304 GCATTAAACCAGAGAGGATGAGG + Intronic
1118942291 14:70348960-70348982 GGAGTAAAGAGGAGAGAACAAGG - Intronic
1118959315 14:70514334-70514356 GGACTAAAGCACAGAGAGCAAGG - Intergenic
1119961710 14:78865721-78865743 GAATTAAACAAAAGAGACCATGG + Intronic
1120002959 14:79324174-79324196 GAATTAAACCAGACAGAATCAGG + Intronic
1120102492 14:80461378-80461400 AGAGTAAAACAGAAAGAACAGGG + Intergenic
1120414283 14:84199786-84199808 AGATTGAGCCAGAGAGATCAAGG - Intergenic
1121174353 14:91879581-91879603 GGAAAAACCCAGAGAGAACCAGG + Intronic
1121577221 14:94998138-94998160 GGAATAGACCAGAAAGAACAAGG + Intergenic
1122085713 14:99301668-99301690 GGAATAAAGCAGAGAGAGAATGG + Intergenic
1122244883 14:100395351-100395373 GGATTAAACAAGAGAACCCACGG + Intronic
1202934431 14_KI270725v1_random:72234-72256 AGGTTAAACCAGAGGGAACCAGG - Intergenic
1123782246 15:23639999-23640021 CGATCAAATCAGAGAGAAAAAGG + Intergenic
1124798083 15:32802191-32802213 GAATTATAGCAGAGAGAAAAGGG - Intronic
1126437791 15:48653628-48653650 GGTTTAAACCAGAGATCAGATGG - Intergenic
1127456309 15:59159061-59159083 GGATTAAACCAGCTGGAAGAGGG + Intronic
1127858549 15:62973465-62973487 GAATGAAGCCAGAGAGAATAGGG + Intergenic
1129921887 15:79326446-79326468 TTATAGAACCAGAGAGAACATGG - Intronic
1131186924 15:90282361-90282383 GGATCAAATGAGAGAGAATATGG - Intronic
1132631141 16:918050-918072 GGGTTAAACCAGAGATCAGATGG + Intronic
1134038424 16:11049708-11049730 GCATTAAACCAGAGGCAATAAGG - Intronic
1134215630 16:12315075-12315097 GGATGAAACCAGAGATTAAAAGG - Intronic
1136004325 16:27318321-27318343 GGATTTTACAGGAGAGAACATGG + Intronic
1138042036 16:53682281-53682303 GAATTAAAGCAGAGACAAAATGG - Intronic
1140822647 16:78677764-78677786 GTATTAAAACAGAGGAAACATGG + Intronic
1141834578 16:86530352-86530374 GGATTAAACCAGGCAGTACAGGG - Exonic
1143328313 17:6116132-6116154 GGACTAAGCCAGAGTGGACAGGG - Intronic
1143855593 17:9845624-9845646 GGACTGAACCAGAGAGGCCAGGG - Intronic
1147761548 17:42800670-42800692 GGATTAAACCAGAGGGAGATGGG + Intronic
1149155996 17:53630613-53630635 GGATTAGACAAGAGAAAAGAGGG - Intergenic
1149792157 17:59488773-59488795 GAATTAAACTAGAGAACACAAGG + Intergenic
1149840717 17:59962273-59962295 GGATTAAAAGAGTTAGAACACGG - Intronic
1150216571 17:63474807-63474829 TGAGAAAACCACAGAGAACAAGG + Intergenic
1154259098 18:12813633-12813655 TGATTAAACCAGACAAAAAATGG + Intronic
1156109499 18:33707849-33707871 TGATTAAAACTGAGAAAACAAGG - Intronic
1156209907 18:34928408-34928430 GGATTTTACCAGAGGGAAAATGG - Intergenic
1156267909 18:35504965-35504987 GGAATAAAACAGAGACAATATGG + Intergenic
1157608783 18:48942950-48942972 GGATGAAGGCAGAGAGGACATGG - Intronic
1159492448 18:69154913-69154935 GGATCAAATCAGAGAAACCAGGG + Intergenic
1159548311 18:69868868-69868890 TGATGAAACAAAAGAGAACATGG + Intronic
1159880893 18:73857569-73857591 AGATTAAATAAGAGAAAACAAGG + Intergenic
1160067816 18:75593866-75593888 GGAGCAGAGCAGAGAGAACAAGG - Intergenic
1160607785 18:80065480-80065502 AGATTAAACCACAAGGAACAGGG - Intronic
1160651472 19:232462-232484 AGATAAAAGCAGAGACAACAGGG + Intergenic
1160899197 19:1418694-1418716 GGATGCAGCCGGAGAGAACACGG + Exonic
1162758756 19:12875771-12875793 CGATTGAACCAGGGAGATCATGG - Exonic
926962869 2:18378025-18378047 GGAATAAACCCGAAAGCACAAGG - Intergenic
929035425 2:37686894-37686916 TGATTAAACCAGTAAGAACATGG + Intronic
930416085 2:51092992-51093014 GGAATAAACCAGAAAGATCCTGG + Intergenic
930850014 2:55950582-55950604 GGATTAAGACAAAGAGAGCAGGG + Intergenic
933167734 2:79094317-79094339 GGAGTAAAGAGGAGAGAACAAGG + Intergenic
933297249 2:80504570-80504592 GAATGAAGCCAGAGAGAGCAAGG + Intronic
935658954 2:105449060-105449082 GGATTAAATCAGTGAGCTCATGG + Intergenic
936042982 2:109163836-109163858 GTAATAGACCAGAGAGATCATGG - Intronic
936702695 2:115032961-115032983 TGATTAAAACAGAGAGCAAAGGG - Intronic
937519227 2:122691253-122691275 AGATTAAGCCAGAGAGATAAAGG + Intergenic
939238481 2:139528568-139528590 GTATAAAATCAGAGAGAACTGGG + Intergenic
939443488 2:142278888-142278910 GGATTAAAGAAGAAAGAATAAGG - Intergenic
939496364 2:142932348-142932370 GGAGTAAAGAGGAGAGAACAAGG + Intronic
943879516 2:193122469-193122491 TAAGTAAACCAGAGAGAACCTGG + Intergenic
945157456 2:206854445-206854467 TGATGTAACCATAGAGAACAGGG - Intergenic
947295574 2:228627011-228627033 GATTTAATCCAGAGAGAAGAGGG - Intergenic
947608641 2:231507891-231507913 GGATTGAGCCAGGGAGATCAAGG - Intergenic
1172503036 20:35440492-35440514 GGGTTGAACCAGAGAGAGCCTGG - Intronic
1173120314 20:40283030-40283052 GGCATAAACCAAAGAGGACATGG - Intergenic
1173859909 20:46276562-46276584 GGATTAAAGGAGATAGAACCTGG - Intronic
1174550783 20:51360060-51360082 GGATTCAACCAGATAGTGCAGGG - Intergenic
1174766724 20:53261321-53261343 GCATTAAAAGAAAGAGAACAAGG - Intronic
1175709843 20:61210661-61210683 TGTTTAAACCAGAGTGAACTTGG + Intergenic
1176706120 21:10120926-10120948 GGATCAAACCAGAGACGCCAGGG - Intergenic
1177146506 21:17412551-17412573 GAATGGAACCAGAGAAAACAGGG + Intergenic
1179393378 21:41014417-41014439 GGATTAAAACAGAAAGAGCATGG + Intergenic
1180670259 22:17547731-17547753 GGATGCAACCAGAAAGAACAGGG - Intronic
1182083284 22:27543980-27544002 TAATTCAACCAGAGAGACCAAGG + Intergenic
1182936464 22:34227443-34227465 GGGCTAAACCAGAGTGAGCAAGG - Intergenic
1184075105 22:42171849-42171871 GGTTTATACCAGTGAGGACAGGG + Intronic
1184897812 22:47422134-47422156 GGCTTCAAAGAGAGAGAACAGGG + Intergenic
950112309 3:10427152-10427174 GGATTGAAAGAGAGAGAAGATGG - Intronic
950315546 3:11998812-11998834 GGATTAAATCAGATAGCACATGG + Intergenic
950378755 3:12593448-12593470 TGATAAAACCAGAGATCACAGGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950473149 3:13198924-13198946 GGAATACACCAGAGTGACCATGG + Intergenic
951526139 3:23654961-23654983 GGAATAAACAGGAGAGAGCATGG + Intergenic
952388064 3:32857163-32857185 GAAGTAAAACAGAGGGAACAGGG - Intronic
952625924 3:35403288-35403310 GGATGAAGCCATAGAAAACAAGG - Intergenic
953008166 3:38997188-38997210 GGAGTGAAGCAGATAGAACAGGG - Intergenic
953857152 3:46508139-46508161 TGATAAACACAGAGAGAACATGG + Intergenic
954330819 3:49889381-49889403 GGGTTAGAACAGAGAGAACCAGG - Intronic
956390035 3:68761938-68761960 TAAATAAACCAGAGAAAACAAGG + Intronic
958021893 3:88007587-88007609 AAATAAAACCACAGAGAACAGGG + Intergenic
959831593 3:110869473-110869495 GGATTAGAGGAGAGAGGACAGGG - Intergenic
960446965 3:117761001-117761023 AAATAAAACCAGAGAGAACTGGG - Intergenic
961030508 3:123599226-123599248 AGACAAAACCAGAGAGAGCATGG + Intergenic
961803491 3:129471014-129471036 GGATTAAAATATAGAGAGCATGG + Intronic
961904547 3:130249067-130249089 GGATGGGAACAGAGAGAACATGG - Intergenic
962093274 3:132267822-132267844 TCATTAAACCAGTGAGGACAGGG + Intronic
963186138 3:142419416-142419438 GGACTACACTAGAGAAAACAAGG + Intronic
964381611 3:156103406-156103428 GCATTGAAGCAGAGAGACCAAGG + Intronic
964645477 3:158954364-158954386 GGATTATACCTCAGAGAACATGG + Intergenic
965517685 3:169639147-169639169 GTATTAATCCAGAGAGAAGTTGG + Intronic
966361924 3:179138993-179139015 AGATTGAACCAGAAAGAACATGG + Intergenic
967616346 3:191572626-191572648 TGCTTAAATCAGAGAGAAAAAGG + Intergenic
967881227 3:194303154-194303176 TGAGAGAACCAGAGAGAACAGGG + Intergenic
969588864 4:8109884-8109906 GGATTCAACCAGAGTGAGAAAGG - Intronic
969728122 4:8937947-8937969 GGAGGAAACCAGAGAGAAACTGG + Intergenic
971078276 4:23176360-23176382 GGACTGAACCAGGGAGAAAATGG - Intergenic
971834453 4:31744691-31744713 GGAGTAAGCCAGAGGAAACAAGG + Intergenic
972473164 4:39426329-39426351 GGCTTGAACCAGGGAGAAGAAGG + Intronic
976299715 4:83506410-83506432 GGAGTAAAGAGGAGAGAACAAGG + Intronic
976549356 4:86377214-86377236 GCCTTAAACCACAGAGAACCTGG - Intronic
977213491 4:94248622-94248644 GAATTAAACCAGAGCTAACATGG - Intronic
977861731 4:101969147-101969169 AGATCAAAACACAGAGAACAGGG + Intronic
978295671 4:107202290-107202312 GGATTAAACCATACAAAACATGG - Intronic
980198056 4:129617478-129617500 GTATTTAACCAAAGAGTACAAGG + Intergenic
980560172 4:134461506-134461528 AGATTAAACCAGAGAGACATAGG + Intergenic
980716276 4:136634285-136634307 TGATTGAACCAGAGAGACCATGG + Intergenic
980856751 4:138450067-138450089 GGATGAAATCAGAGAGGAAAAGG + Intergenic
982094927 4:151912793-151912815 AGATCAAAACAGAGAGAAGAGGG - Intergenic
983860069 4:172694633-172694655 GGAAGAAACCAGAAAGCACAAGG + Intronic
984706952 4:182854550-182854572 TAAGTAAACCAGAGAGAACGAGG + Intergenic
987214913 5:15725127-15725149 AGATTAAAACAGAGATAAAATGG - Intronic
987316286 5:16727822-16727844 GGATTAAACAAGATAAAACTGGG + Intronic
988757869 5:34278722-34278744 GGCATAAAGCAGAGAGACCAAGG + Intergenic
989137469 5:38169176-38169198 GGATTGTACAAGAGAGAACTTGG + Intergenic
991671162 5:69049150-69049172 GGAAGAAACCAGAGTAAACACGG + Intergenic
991999476 5:72421314-72421336 GGATACAACCAGAGAGAAAATGG - Intergenic
993212552 5:84971796-84971818 GGATTAAAACAGATAGCTCAAGG - Intergenic
994595538 5:101828489-101828511 TGATTCAATAAGAGAGAACAGGG + Intergenic
995739074 5:115335405-115335427 GGATTAAATAAGTTAGAACAAGG + Intergenic
995904796 5:117110621-117110643 GGATTAAACCAGTTAGGGCATGG + Intergenic
998377998 5:141703724-141703746 GGATTAAATGAGAGAGTGCATGG + Intergenic
1001148608 5:169206372-169206394 AGAATAACCCAGAGAGAACATGG - Intronic
1002196175 5:177502823-177502845 AGATGAAACGAGAGAGAACAGGG + Intronic
1004133583 6:12945098-12945120 TGCTAAAACCAGAGAGAGCATGG - Intronic
1007143783 6:39606363-39606385 TGATTAAATCAGAGAGCACAGGG - Intronic
1007198951 6:40088952-40088974 GAATCAAACCAGAGACAAGAGGG + Intergenic
1011281941 6:85686501-85686523 GGGAAAAAACAGAGAGAACAGGG + Intergenic
1011851342 6:91633099-91633121 CAATCAAACCAGAGAGTACAGGG - Intergenic
1014780181 6:125556498-125556520 GGATGAAATCAGAGAAATCAAGG + Intergenic
1014838837 6:126193135-126193157 GGATTAAACCAGGAAGAAAATGG - Intergenic
1015105365 6:129530337-129530359 GGACTAAAACAGAGAGAAATGGG + Intergenic
1015369869 6:132438558-132438580 AAAGTAAACCAGAGAGAACCTGG + Intergenic
1016167546 6:140965697-140965719 GGATTAAACAAGAAAAAGCAGGG - Intergenic
1019631308 7:2051285-2051307 GGTTTATACCAGAGAGACCGAGG - Intronic
1023961201 7:44927801-44927823 GCATCAAACCAGATAGACCACGG + Intergenic
1024222812 7:47301811-47301833 CCATGAAACCAGAGAGGACAGGG - Intronic
1027936018 7:84603563-84603585 GCCTCAAACCAGAGAGGACAGGG - Intergenic
1028271593 7:88797530-88797552 GGATTAAACCAGAGAGAACATGG + Intronic
1028754594 7:94420739-94420761 GGAATATACCAGATAGAAGATGG + Intronic
1028788984 7:94831946-94831968 GGATGAAGCTAGAGAGAACTAGG - Intergenic
1029012508 7:97277104-97277126 GGATTAAACATGAATGAACAAGG - Intergenic
1030123706 7:106134954-106134976 GGATTAACTCAAAGGGAACAGGG - Intergenic
1031505649 7:122578756-122578778 AGGTCAAATCAGAGAGAACAAGG + Intronic
1031907539 7:127477257-127477279 GGATTAAAACAGAAGGAATAAGG + Intergenic
1032484324 7:132272787-132272809 TGAGAAAACCAGAGAGAAAATGG - Intronic
1032548264 7:132761612-132761634 GGCTGGAAACAGAGAGAACATGG + Intergenic
1032589185 7:133176719-133176741 TGAATATTCCAGAGAGAACAAGG + Intergenic
1032732151 7:134654314-134654336 TGATTAAAGCAGTGAGAAAAGGG + Intronic
1032899034 7:136285517-136285539 TGATGAAACCAGAGAGAAGGAGG + Intergenic
1035559209 8:592695-592717 GAACGAAAGCAGAGAGAACAAGG + Intergenic
1037286359 8:17304850-17304872 GGATTAAATGAGAGAAAACGTGG - Intronic
1038139825 8:24832219-24832241 AAATCAAACCAGAGAGAAGAAGG + Intergenic
1038698421 8:29827108-29827130 GGAAGAAACGAGAGAGAACCTGG + Intergenic
1040707846 8:50150997-50151019 GAATTCTACCAGAGATAACAAGG - Intronic
1041207732 8:55515275-55515297 GGTTTAAAACAGAGATAAAATGG + Intronic
1041971419 8:63747281-63747303 GCATTAAACCTGATAGCACAGGG + Intergenic
1044374479 8:91453221-91453243 AGATTAAAACAGAGAAAAAAAGG - Intergenic
1044797398 8:95917877-95917899 GTATTTCACTAGAGAGAACAAGG - Intergenic
1044930654 8:97248722-97248744 GGATGTAACCAGAGAGGTCAAGG - Intergenic
1045183363 8:99810945-99810967 GCATTGAGCCAAAGAGAACAAGG + Intronic
1046239922 8:111477025-111477047 GGATTTAGCCAGAGACAATAAGG - Intergenic
1046564207 8:115877932-115877954 GGAGGAAACCAGAGAGAAGAGGG + Intergenic
1047209715 8:122831550-122831572 GGAGTAAAGCGGAGAGAACAAGG + Intronic
1047478779 8:125260582-125260604 GAATTAAACCACAAAGAAGACGG - Intronic
1047483612 8:125308167-125308189 GGATTATACTGTAGAGAACATGG - Intronic
1050112329 9:2229634-2229656 ACATTAAACCAAAGAAAACAAGG + Intergenic
1051099217 9:13502012-13502034 AGAATAAAGCAGAGAGGACAAGG - Intergenic
1051339589 9:16099278-16099300 AGAATAAACCAGGGGGAACAGGG - Intergenic
1053573035 9:39329595-39329617 GGATGAGACCAGGGAGAAAAAGG - Intergenic
1054124109 9:61289416-61289438 GGATGAGACCAGGGAGAAAAAGG + Intergenic
1057178678 9:93017543-93017565 GGATAAGACCACAGAGACCATGG - Intronic
1057280103 9:93703456-93703478 GGATTAAACAAGAAATAACAAGG - Intergenic
1058161855 9:101578781-101578803 GGGAAAAAGCAGAGAGAACAGGG + Intronic
1058170005 9:101669277-101669299 GGTTCAATCCAGAGAGAACATGG + Intronic
1058601154 9:106671856-106671878 TGATTAAACAAGAGACAAAAGGG + Intergenic
1059468329 9:114483880-114483902 TCATTAAAGCAGAGAGATCAGGG + Intronic
1060189858 9:121585447-121585469 GGATTAAAGCACTTAGAACAGGG + Intronic
1060450346 9:123732910-123732932 GGATTAAATGAGAGAGCGCATGG + Intronic
1061897114 9:133654031-133654053 GGATTAAAACACAAAGAATAGGG - Intronic
1202791154 9_KI270719v1_random:91014-91036 GGATCAAACCAGAGACGCCAGGG - Intergenic
1186930839 X:14388048-14388070 GAATTGAAGCAGAAAGAACAGGG - Intergenic
1187265337 X:17726846-17726868 TGGATAAACCAGAGTGAACAAGG + Exonic
1189666907 X:43365631-43365653 GGATCAAATAAGAGAGTACATGG + Intergenic
1190145375 X:47886680-47886702 TGATTAAACCTGAGAGGTCAAGG - Intronic
1190755856 X:53401298-53401320 GGATTGAAACAAAGAGGACAAGG - Intronic
1192895236 X:75436045-75436067 AGATTAAACCAGAAAGAAATGGG - Intronic
1192945858 X:75965037-75965059 GGAGTAAAGAGGAGAGAACAAGG + Intergenic
1194332797 X:92604629-92604651 GGATTAAACAACATAAAACAAGG + Intronic
1194932733 X:99907516-99907538 GGGTTAAACCAAAGAGAATGAGG - Intergenic
1195338631 X:103882016-103882038 GGATTAGACAACAGAGAAGATGG - Intergenic
1195422550 X:104691883-104691905 GTATTCATCCAGACAGAACAAGG + Intronic
1195785084 X:108510629-108510651 GAATTAGAACAGAGAGAAAAGGG + Intronic
1198579494 X:138048322-138048344 GGAACAATCCAGAGAGAAGAAGG + Intergenic
1198887561 X:141355959-141355981 TGAATGAGCCAGAGAGAACATGG - Intergenic
1199930664 X:152516429-152516451 AGAATAAAACAGAGAGAAAATGG + Intergenic
1200641490 Y:5723673-5723695 GGATTAAACAACATAAAACAAGG + Intronic
1201505095 Y:14689726-14689748 GGATTAGACGAGGGAGAAGAAGG + Intronic
1201749204 Y:17413873-17413895 GGAGTAAATCAAAGACAACAAGG + Intergenic