ID: 1028273173

View in Genome Browser
Species Human (GRCh38)
Location 7:88818289-88818311
Sequence TTATGCCAACTCGAGATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028273173_1028273174 -2 Left 1028273173 7:88818289-88818311 CCAAAAATCTCGAGTTGGCATAA 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1028273174 7:88818310-88818332 AAAGTCATTGCTGATAAATTAGG No data
1028273173_1028273175 -1 Left 1028273173 7:88818289-88818311 CCAAAAATCTCGAGTTGGCATAA 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1028273175 7:88818311-88818333 AAGTCATTGCTGATAAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028273173 Original CRISPR TTATGCCAACTCGAGATTTT TGG (reversed) Intronic
903607248 1:24584059-24584081 TAATGCCACCTCGATATTCTAGG - Intronic
905703415 1:40036592-40036614 TTTTGCCAACTCCTAATTTTTGG + Intergenic
908594022 1:65666742-65666764 TTATTTCAGCTCCAGATTTTGGG + Intergenic
908779608 1:67677722-67677744 TTATGCCTACTGTGGATTTTGGG + Intergenic
910418519 1:87028678-87028700 TTTTGCAAACTCTAAATTTTGGG + Intronic
912839528 1:113026623-113026645 TTAGGCCAAATCAAGATTTCTGG + Intergenic
915138166 1:153748704-153748726 TTCTGCCAACCAGATATTTTTGG - Exonic
916143679 1:161722006-161722028 TTATGAGAACTCAAGATTTCAGG + Intronic
917708707 1:177661129-177661151 TTATTTCAACTCTACATTTTTGG - Intergenic
924150580 1:241125140-241125162 TTAAGCCAACTGGAGATTTGTGG + Intronic
1066228452 10:33407899-33407921 TTATGGCAACTGGAGATTCATGG + Intergenic
1068039227 10:51801667-51801689 TTAAGCCAAATCCAGATTTGTGG + Intronic
1068269706 10:54705158-54705180 TGATGCCTACTTGAGAGTTTAGG + Intronic
1077779236 11:5307162-5307184 TTTTGCCAAAACGTGATTTTAGG + Intronic
1082869958 11:57935177-57935199 TTATTCCAACTCCAGCTTTCTGG - Intergenic
1083170293 11:60920240-60920262 TTTTGCCATTTCGAGATTCTAGG - Intronic
1084290134 11:68159142-68159164 TTACGCCAACTGAAGATTTTCGG + Exonic
1087840428 11:102915071-102915093 TTATCCCAGCTAGAGATTCTGGG - Intergenic
1090847260 11:130540699-130540721 TAATGCCAACTACGGATTTTGGG - Intergenic
1091085073 11:132713646-132713668 TTGGGCCAACTCCAGATTTCTGG - Intronic
1095702554 12:45205355-45205377 TAATGCTGACTCGAGAGTTTTGG + Intergenic
1098902662 12:76128964-76128986 TTATGCCAACATAAGATATTTGG - Intergenic
1103965268 12:124634810-124634832 TGTTGCCAATTCGACATTTTAGG + Intergenic
1110043145 13:70791792-70791814 TTATCTCAACTTGAAATTTTTGG - Intergenic
1114764838 14:25359166-25359188 TTCAGCTAACTCCAGATTTTAGG - Intergenic
1122844014 14:104480913-104480935 TGATGGCGACTCGAGATTTGTGG + Intronic
1132149626 15:99450438-99450460 TTTTGCCAACTCCAGAACTTAGG - Intergenic
1133989903 16:10696654-10696676 TCATACCCACTCGTGATTTTAGG - Intergenic
1137583530 16:49649882-49649904 TAATTCTAACTCGAGATTTCAGG - Intronic
1141304353 16:82847376-82847398 TTATGCCATCTCCAGTTTCTAGG + Intronic
1153109894 18:1573673-1573695 TTCTGCCAAATCTTGATTTTTGG + Intergenic
1157476188 18:48025091-48025113 TTAGGGCAACTCCAGATGTTAGG + Intergenic
934912175 2:98269231-98269253 TTATCCCAGCTAGAGATTTGGGG + Intronic
942765680 2:179453644-179453666 TTATGCCAAACTGAGATTATAGG - Intronic
943650011 2:190447376-190447398 TTGTGCCAACTAGAGAGCTTTGG + Intronic
948228061 2:236328331-236328353 ATATTTCAACTCGAGATTCTGGG + Intronic
1169683927 20:8248965-8248987 TCATTTTAACTCGAGATTTTAGG + Intronic
1174488953 20:50878757-50878779 TTGTGCCAACACTACATTTTGGG - Intronic
954727955 3:52631941-52631963 TGATTCCAACTTAAGATTTTTGG + Intronic
955518095 3:59747990-59748012 ATATGCCAAATGGAGAGTTTCGG + Intergenic
962867711 3:139461287-139461309 TTCTGCAAACTCAAGTTTTTGGG + Intronic
964524608 3:157605259-157605281 TTAAACCAACAAGAGATTTTGGG + Intronic
964573650 3:158140113-158140135 TTCTCCAAACTTGAGATTTTGGG + Intronic
964691158 3:159451595-159451617 AGATGCCAACTAGAGATTCTTGG - Intronic
965744329 3:171908016-171908038 TTAGGCCAACTTGAATTTTTAGG + Intronic
970264057 4:14261555-14261577 TTATGCAAATTTGAAATTTTGGG + Intergenic
972922339 4:43959531-43959553 TTTTGCCAACTGGAGATCCTGGG + Intergenic
981685956 4:147455265-147455287 TTATGCCAAGGGGACATTTTTGG - Intergenic
985348315 4:189031169-189031191 TTACGCCAACTCTATTTTTTTGG - Intergenic
986886905 5:12249832-12249854 TTATGCCAGCTAGAGACTATGGG + Intergenic
990132139 5:52598841-52598863 TTATGTGAACTCGTGAGTTTAGG - Intergenic
994141262 5:96344110-96344132 TTATGTCAAATCTACATTTTGGG + Intergenic
995013361 5:107282515-107282537 TACTACCAACTAGAGATTTTAGG - Intergenic
995990215 5:118229517-118229539 TAATGCCAACTCTAGATAGTGGG - Intergenic
999259495 5:150229260-150229282 TTAAGCCATCTGGAGAATTTGGG - Intronic
1004048916 6:12054142-12054164 TGATGCCAACTCAAGATATTTGG + Intronic
1005058012 6:21748275-21748297 TTAACCCAACATGAGATTTTTGG - Intergenic
1005225761 6:23639994-23640016 TTATGCCCACTCAAGATTGAGGG + Intergenic
1012918284 6:105194679-105194701 TTTTGCCAACTCTAGATCATAGG - Intergenic
1013580945 6:111534004-111534026 TAATGACAACCTGAGATTTTTGG + Intergenic
1013615037 6:111834911-111834933 TTATGCCAAGTTGAGAGTCTGGG - Intronic
1014632796 6:123807292-123807314 TTATGCCAACTTCAGATTTTAGG + Intronic
1017642221 6:156505361-156505383 TTATGCCAGCTCTAAATTTCGGG + Intergenic
1018778836 6:167044220-167044242 TTATGCCACTCCGAGATTTGAGG + Exonic
1020873697 7:13667824-13667846 TAATGCCAACTCTAGTGTTTTGG + Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1023857104 7:44190709-44190731 TTCTGCCAACACGAGAAGTTTGG + Intronic
1028089235 7:86677069-86677091 TTATACCAACACTGGATTTTGGG - Intronic
1028273173 7:88818289-88818311 TTATGCCAACTCGAGATTTTTGG - Intronic
1048759678 8:137779752-137779774 TTATGCAACCTCTAGAATTTTGG - Intergenic
1050626158 9:7505789-7505811 TTAGGCCAAATGAAGATTTTTGG - Intergenic
1058158370 9:101540231-101540253 TTCTGCCAGCTTGCGATTTTTGG - Exonic
1188726766 X:33594148-33594170 TTATGCCAACTCTGATTTTTAGG + Intergenic
1192533410 X:71908935-71908957 GTTTGCCAAATCGAGAATTTGGG + Intergenic
1194005093 X:88481662-88481684 TTATGTCATCTCAAGATATTTGG - Intergenic
1199310233 X:146312952-146312974 TCATGCCAACACTTGATTTTTGG + Intergenic
1199969080 X:152845385-152845407 TTTTGCCATCTCCAGATGTTAGG + Intronic