ID: 1028279751

View in Genome Browser
Species Human (GRCh38)
Location 7:88907672-88907694
Sequence ACATTTAAAATGAGGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028279745_1028279751 17 Left 1028279745 7:88907632-88907654 CCAAAGTTTGGGGCCTTTAACTT 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1028279751 7:88907672-88907694 ACATTTAAAATGAGGGAGCATGG 0: 1
1: 0
2: 0
3: 24
4: 351
1028279747_1028279751 4 Left 1028279747 7:88907645-88907667 CCTTTAACTTTGTAAGTGGTAGA 0: 1
1: 1
2: 0
3: 17
4: 161
Right 1028279751 7:88907672-88907694 ACATTTAAAATGAGGGAGCATGG 0: 1
1: 0
2: 0
3: 24
4: 351
1028279744_1028279751 18 Left 1028279744 7:88907631-88907653 CCCAAAGTTTGGGGCCTTTAACT 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1028279751 7:88907672-88907694 ACATTTAAAATGAGGGAGCATGG 0: 1
1: 0
2: 0
3: 24
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028279751 Original CRISPR ACATTTAAAATGAGGGAGCA TGG Intronic
901572423 1:10172264-10172286 ACGTTGAAAATGAGGCAGAACGG - Intronic
903046147 1:20565767-20565789 AGATTTGAAATGATGGAGCCAGG + Intergenic
903617559 1:24672411-24672433 ACATGTAAAAAAAGGGGGCATGG + Exonic
904310531 1:29626530-29626552 ACACTGAAAATGAGGGGGCTGGG - Intergenic
905016015 1:34779411-34779433 GTTTTTAAAATGAGAGAGCAAGG + Intronic
905016247 1:34780926-34780948 GTTTTTAAAATGAGAGAGCAAGG + Intronic
905644949 1:39618745-39618767 ACAGTTTAACTGAGGGAGCCAGG - Intergenic
906199980 1:43953693-43953715 ACATTTCAAAGGAGAGAGCCAGG - Intronic
906420314 1:45660447-45660469 ACATTTAAAAAGGGGGGGAAGGG + Exonic
907454581 1:54567120-54567142 ACATTTAAAGAGAGGAATCAAGG - Intronic
907671539 1:56478495-56478517 ATAATTAAAATGACGGAGCATGG - Intergenic
908408159 1:63835217-63835239 CATTTTAAAATGAGTGAGCAAGG - Intronic
908445827 1:64198767-64198789 AGATTTAAAAAGAGGAAGAAAGG + Intergenic
909050721 1:70764866-70764888 ACTTTTAAAATGACAGAGGAAGG + Intergenic
909417616 1:75425363-75425385 ACAATTAAAATCAGAGAGAAAGG + Intronic
909778903 1:79517406-79517428 ATATTTAAAATGAGAGATTAGGG + Intergenic
911690442 1:100827174-100827196 TCATTGAAAAAGAGGGAGTAGGG - Intergenic
911821406 1:102428227-102428249 ATAACTAAAATGAAGGAGCAAGG + Intergenic
912268340 1:108182862-108182884 GCAGTAAAAATAAGGGAGCAAGG + Intronic
912333459 1:108841213-108841235 AGAAATAAAATGATGGAGCAAGG + Intronic
916965537 1:169938511-169938533 ACATTGAAAATGAAACAGCATGG + Intronic
918887452 1:190213749-190213771 ACAATTGAAATGAGAGAGAAAGG + Intronic
919252968 1:195083134-195083156 ACATGGAAAAAGAGGAAGCAAGG + Intergenic
919261745 1:195205072-195205094 ACTTATAAGATGAGGGAGAACGG + Intergenic
919294578 1:195679744-195679766 ACACTGAAAATGAAGGAGGATGG + Intergenic
919994699 1:202738269-202738291 ACATATAAAATCAGAAAGCAAGG - Intronic
920023249 1:202971569-202971591 AAATTTAAAATGAGACAGCTGGG - Intergenic
920797073 1:209149452-209149474 ACATTTAAAAGTAGGAAGTAGGG - Intergenic
921109694 1:212022901-212022923 ACTTTTAAAAGTAGGGAGGAAGG - Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921315414 1:213885849-213885871 ACATCCAAAATGAGGCAGCCGGG + Intergenic
923062915 1:230492523-230492545 ACATTTGTAATGAGGAAGCCTGG - Intergenic
923416041 1:233761211-233761233 GCAGTTAAAATGAGTGAACAAGG + Intergenic
924476736 1:244388806-244388828 GCATTTAAAATGTGGGAAAAAGG - Intronic
1064163114 10:12962669-12962691 ACATTTAAAATGACACATCAAGG + Intronic
1067056180 10:43052857-43052879 AGATTTAATATTTGGGAGCAAGG - Intergenic
1067963915 10:50887759-50887781 ATTTTTAAAATGAGGGACCTAGG + Intergenic
1067985031 10:51133976-51133998 AGATTCTAAATGAGGGAGCAGGG - Intronic
1072409135 10:95184128-95184150 ACTTTGAAGATGAGGAAGCAGGG + Intergenic
1073238773 10:102039753-102039775 ACAATTGAAAGGAGGGAGGAAGG - Intronic
1074248323 10:111716471-111716493 ACATTAAAAATGAGGCACAATGG + Intergenic
1075365488 10:121884592-121884614 ACAATGAAAAAGAGGGAGGAAGG + Intronic
1077027162 11:445998-446020 ACAGTTAAAAGGAGGCTGCAGGG - Intergenic
1079141584 11:17814051-17814073 ACTTTAAAAAGGAGGGAGGAAGG + Intronic
1079307649 11:19337805-19337827 AGATTATAAAAGAGGGAGCAGGG - Intergenic
1079612973 11:22456079-22456101 ACATTTGAAAAGAGTGAACAGGG + Intergenic
1080429020 11:32181789-32181811 ACATTCAAAATGATGGGGAAGGG - Intergenic
1080734500 11:34999502-34999524 ACCTATAAAATGAGGAAGCAAGG + Intronic
1080865998 11:36195580-36195602 ACATTTTAAAATAGGGAGAAAGG + Intronic
1081963161 11:47153114-47153136 ACATCTGGATTGAGGGAGCAGGG - Intronic
1082087755 11:48064189-48064211 ACAGTTAAAATGAGGGTAGAGGG - Intronic
1084893508 11:72249371-72249393 ATTTTTAAAAAGAGGGAGAAGGG - Intergenic
1085370562 11:76000095-76000117 GCATTTAAAAAGAGAGAGAAAGG + Intronic
1086306411 11:85485407-85485429 AAATTTAAAATGTGGAAGGATGG + Intronic
1089310040 11:117551994-117552016 ACTTTTGAAAGGAGGGAGTATGG + Intronic
1089898762 11:121959718-121959740 AGATTTAAAACTAAGGAGCAAGG + Intergenic
1090129064 11:124120503-124120525 ACATTAACAATGAGAGAGTAGGG - Intronic
1091644375 12:2262788-2262810 ACATTTAAAAAGCAGGGGCAAGG - Intronic
1091690268 12:2591475-2591497 ACATTTAAAATCAGTCATCAAGG + Intronic
1092359241 12:7822257-7822279 ACATTTAAAAAGAGAAAGGAGGG - Intronic
1094193567 12:27721775-27721797 ACATTTAAAAAGAAGAAACATGG - Intronic
1094668927 12:32549675-32549697 AGATTGAAAATGAGGGCACATGG + Intronic
1094845061 12:34357877-34357899 ACATTTAAAAGGGGAGATCAAGG - Intergenic
1096449186 12:51722697-51722719 ACATTTTATATGGGGGAGGAAGG + Intronic
1098034435 12:66287807-66287829 AAGTTTAAAATGGGGAAGCAGGG - Intergenic
1098082643 12:66805711-66805733 AAATTGATAATGATGGAGCAGGG + Intergenic
1098424842 12:70350744-70350766 ACATATAAAATGAGGTATCTTGG - Intronic
1099310197 12:81010746-81010768 ACATTCAAACTGAGAGAGAAGGG + Intronic
1100675767 12:96865061-96865083 ACATTTCAAATGAGAGAAAATGG - Intronic
1100884429 12:99054448-99054470 AACTTTAAAATGAAGGAGTAGGG - Intronic
1101011064 12:100449920-100449942 ACATTTAAAATGAGAAGGCAGGG + Intergenic
1104421594 12:128640598-128640620 ATATTTTAAATGAGTGAGCCAGG + Intronic
1105340404 13:19517831-19517853 TCATTAAAGATGAGGGAGAAGGG + Intronic
1106753876 13:32801713-32801735 ATAGTGAAAATGAGTGAGCATGG + Intergenic
1107703643 13:43076245-43076267 ACTTTTCAAATGAGAGATCAAGG - Intronic
1109646117 13:65259651-65259673 GCATCTAAACTGAGGCAGCAGGG + Intergenic
1109925014 13:69125855-69125877 ACATTTATAATGAGGGATAGCGG - Intergenic
1109971418 13:69775238-69775260 ACATCTAAAGAGATGGAGCAAGG + Intronic
1113123032 13:106944568-106944590 TCATTCAGAATGAGGAAGCACGG + Intergenic
1113514662 13:110884842-110884864 ACATTTAAAAATAGGGAGAATGG + Intronic
1114702158 14:24690060-24690082 AAATTTAATGTGAGGAAGCATGG + Intergenic
1114939429 14:27589294-27589316 ACATTCAAAATAAGGGAGATTGG + Intergenic
1115372520 14:32633928-32633950 ACATTTAAAATAAGGAGCCATGG - Intronic
1117792548 14:59356378-59356400 ACATTAAAAATAAGGTGGCAGGG - Intronic
1117921006 14:60724737-60724759 ACATCCAAAAAGAGGGAGAATGG - Intergenic
1117993833 14:61460211-61460233 CCATTAAAAATGAGGCAGCTTGG - Intronic
1118978045 14:70694162-70694184 ACATTTTAAATGGGGTAGCCAGG - Intergenic
1119564694 14:75618627-75618649 TAATTTAAAATGTGGGAGAACGG - Intronic
1119837092 14:77760381-77760403 CCACTTAAAATGGGGCAGCAAGG + Intronic
1120033268 14:79666912-79666934 ACTTTTTAATTGAGGCAGCAAGG - Intronic
1120969278 14:90193806-90193828 ACATTTACCCCGAGGGAGCATGG - Intergenic
1121808249 14:96852164-96852186 AGAAGTAAAATGAGAGAGCAGGG - Intronic
1122561042 14:102614522-102614544 ACATTTAAAAAGAGCCAGAAGGG - Intronic
1124012806 15:25852261-25852283 GCATTTAACAGGAGGGAGGATGG - Intronic
1124391321 15:29260811-29260833 ACTTTTAAAATAAGGCAGGAAGG + Intronic
1125583060 15:40801009-40801031 AAATGTAAAATGAAGGAGTAGGG - Intronic
1126218157 15:46181424-46181446 ACATGGAAAGAGAGGGAGCAAGG + Intergenic
1126229049 15:46304174-46304196 ATATTTAAAATGAGATAGAATGG + Intergenic
1126831260 15:52608219-52608241 GCCTTTAAGATGGGGGAGCAGGG + Intronic
1127960535 15:63887187-63887209 CCTGTTAAAAAGAGGGAGCAGGG - Intergenic
1128078096 15:64841074-64841096 CAATGTAAAATGAGGGCGCATGG + Intergenic
1129012592 15:72435878-72435900 ACATTAACAATGAGGAAGCTGGG - Intergenic
1129222482 15:74139351-74139373 ACATTTAAAAAGAGGTAGGAAGG - Intergenic
1132020344 15:98355965-98355987 AAATATAAAAGGAGGCAGCATGG - Intergenic
1134374668 16:13660797-13660819 ACATTTAAAATAAGGGTGGGTGG + Intergenic
1135505505 16:23032615-23032637 ATATTTAAAAAGAGCTAGCACGG + Intergenic
1136990802 16:35150381-35150403 ATATTGGAAATGAAGGAGCAGGG - Intergenic
1138131156 16:54481215-54481237 ACTATTAAAATGTGGGAGCATGG - Intergenic
1138682212 16:58693327-58693349 GCCTTTTAAATGAGAGAGCATGG + Intergenic
1140325225 16:73994911-73994933 ATATTTAAACTGAGGGCGGAAGG - Intergenic
1143244908 17:5476026-5476048 ACATTTAAAATGAGTTAAGATGG + Intronic
1144105257 17:11978539-11978561 ACATTCAGGATGAGGGAACAGGG - Exonic
1145690521 17:26733893-26733915 AAATTTAAAATAAGGGGGGAAGG + Intergenic
1147424545 17:40339860-40339882 ATCTTTCAAATGATGGAGCAAGG - Intronic
1151393349 17:73802654-73802676 CCATGTAAAATTAGGCAGCATGG - Intergenic
1151812340 17:76452162-76452184 GCAATTAAAAGGAGGCAGCAGGG + Intronic
1151878123 17:76878892-76878914 TCATGTAAAATGAGGGGGCTGGG - Intronic
1152551062 17:81030527-81030549 ACATTTAAAAGGAAGGGGCCCGG - Intergenic
1154304496 18:13220278-13220300 TCATTTAAAACAAGGGAGGAAGG - Intronic
1155107949 18:22686425-22686447 ACATGGCAAAAGAGGGAGCAAGG + Intergenic
1155622294 18:27793573-27793595 ACAGGCAAAATGTGGGAGCAGGG + Intergenic
1156226403 18:35113598-35113620 ACATTTAAAATGTGGAAGGAAGG + Intronic
1158240188 18:55368733-55368755 ATATTTAAAAAGAGGGAGACTGG + Intronic
1158657789 18:59356136-59356158 ACCTGTAAAATGAAGGAGCTAGG + Intronic
1161611106 19:5243434-5243456 GCATTTAAAATCGGGGAGCTAGG - Intronic
1163580451 19:18135721-18135743 TCATCTAAAATGAGGGAGGGAGG - Exonic
1166915713 19:46194815-46194837 ATATATAAAATGAGGAAGCCTGG - Intergenic
1167689882 19:50978769-50978791 ACAGTAAAAAGGAGGGGGCAAGG + Intronic
926096085 2:10081007-10081029 ACTTTGAAAATGAAGGAGAAAGG + Intergenic
926503764 2:13685457-13685479 ACATTTGAATTGAAGAAGCATGG + Intergenic
926701456 2:15806901-15806923 ACATTTACTGTCAGGGAGCAGGG + Intergenic
926836495 2:17029286-17029308 AAATTTAAAAAGAGGGAGTGAGG + Intergenic
928070938 2:28215800-28215822 AAAAGTAAAATGAGGGAGAAAGG - Intronic
928216692 2:29367415-29367437 ATCTGTAAAATGAGGGAGGAAGG + Intronic
928273952 2:29881843-29881865 AGGTTTAAAATGAGGGAAAATGG - Intronic
928529058 2:32171993-32172015 ACATTAAAAATGAGAAAACATGG - Intronic
928740850 2:34350694-34350716 AATTTTAAAATTAGAGAGCAGGG - Intergenic
929622168 2:43365958-43365980 ACATATAATATGTGGGAGCAGGG + Intronic
930417652 2:51109152-51109174 ACATTTTATCTAAGGGAGCAGGG + Intergenic
930463291 2:51711311-51711333 ATATTTAAAATGAGAAATCATGG - Intergenic
930520554 2:52461076-52461098 ACATTTAGAATGGGAGAGCCTGG + Intergenic
930794507 2:55373977-55373999 ACATTTAAAATGTGGTATAAAGG + Intronic
930940127 2:57002101-57002123 ACATTTTTCATGAAGGAGCAGGG - Intergenic
931235743 2:60411041-60411063 AGATTTGAAATGGGGGAGCAGGG - Intergenic
931502484 2:62884542-62884564 ATATATAAAATGAATGAGCATGG - Intronic
933528289 2:83472523-83472545 ACTTGTAAAATGAGGTAACATGG + Intergenic
933981848 2:87556751-87556773 ACATTTAAAGTAAGTTAGCAAGG - Intergenic
935534959 2:104283460-104283482 ACATTCAATGTGAGGGAGCAAGG - Intergenic
936049172 2:109210390-109210412 ACAGACAAAACGAGGGAGCACGG - Intronic
936311990 2:111394066-111394088 ACATTTAAAGTAAGTTAGCAAGG + Intergenic
937502229 2:122491669-122491691 AAATCTAAAAAGAGAGAGCATGG - Intergenic
937625123 2:124035285-124035307 ATATTGAAAATAAAGGAGCAGGG - Intronic
938660028 2:133476943-133476965 TCATTTCAAATAAGGGACCATGG - Intronic
939127658 2:138196583-138196605 ATATTTAAAATGAGAAAGGATGG - Intergenic
939617533 2:144377922-144377944 ACATTTAAAATTAAGGGGCAGGG - Intergenic
939639774 2:144626050-144626072 ACATTTTAGATGAGGAAGCTGGG - Intergenic
939702746 2:145414011-145414033 GCATTTAAAATGAGAGTGCAAGG + Intergenic
940692744 2:156939793-156939815 GAATTTAAACTGAGGGAGCATGG - Intergenic
941167898 2:162103185-162103207 AGATTTAGAGTGAGGGGGCATGG + Intergenic
942200748 2:173568583-173568605 ACATTTAAAAAGATGAAACAGGG - Intergenic
942510178 2:176690174-176690196 TCATCTTAAATGAGGGAGGAAGG - Intergenic
942702043 2:178723077-178723099 AGATTGAAAATGAGGCAGGAAGG - Exonic
943079694 2:183243675-183243697 ACACTGAAAAAGAAGGAGCAAGG - Intergenic
943778022 2:191788722-191788744 ACAATTAAAATAAGTAAGCATGG + Intergenic
943833197 2:192487844-192487866 ACATTTAAAAGGTGGGTCCAGGG - Intergenic
944177178 2:196844474-196844496 AAATTTAAAATGAAAGAACATGG - Intronic
944233589 2:197421333-197421355 ACTTTTAAAATGATTAAGCAAGG + Intronic
945844786 2:214931212-214931234 AGATTTAAAATGAGAAAGCCGGG + Intergenic
946113346 2:217439411-217439433 ACTTTTAAAATGAGAGAGGCTGG + Intronic
946442825 2:219711246-219711268 AGGTTTAAAATGGGGGGGCATGG + Intergenic
946532540 2:220587674-220587696 ACAGTAAAGGTGAGGGAGCAGGG - Intergenic
949056824 2:241932392-241932414 ACATTTAAGTTGAGGGGTCAGGG - Intergenic
1168966124 20:1899101-1899123 ACATTTAAAAAGAGAGAGAGAGG - Intronic
1169689580 20:8315591-8315613 ATGTATAAAATGAGGGAGGAAGG + Intronic
1170618502 20:17974363-17974385 ACATTTTAAAAAAGGGAACATGG - Intronic
1170834423 20:19871460-19871482 CCTACTAAAATGAGGGAGCAGGG + Intergenic
1172267093 20:33625799-33625821 AAATTAAAAATGAGGCAGGAGGG + Intronic
1173102673 20:40101758-40101780 ACATTTAAAATAATTGAACAAGG - Intergenic
1173356803 20:42300643-42300665 ACATTGAAAATAGGGGAGAAAGG + Intronic
1173364994 20:42377013-42377035 ACATAGAAAGAGAGGGAGCAAGG + Intronic
1173438435 20:43053832-43053854 CCAATGAAAATGAGGGAGAAAGG + Intronic
1173974628 20:47178028-47178050 ACATTTAAGATGAGGCCGTAAGG + Intronic
1174138419 20:48396412-48396434 AAAAGTAAAATGAGGGAGAAGGG + Intergenic
1175452420 20:59080854-59080876 GCATTAAAAATGAGGCAGGAAGG + Intergenic
1175633507 20:60561287-60561309 TCATTCAAATTGAGGCAGCATGG - Intergenic
1176733724 21:10523256-10523278 TCATTAAAGATGAGGGAGAAGGG - Intronic
1178509116 21:33187809-33187831 ATTTTTAAAGTGAGGGAGGAGGG + Intergenic
1178527715 21:33346332-33346354 ACAGAAAAAATGAGGGAGAAGGG + Intronic
1178547457 21:33504481-33504503 ACCCTTAAAAGAAGGGAGCAAGG + Exonic
1178694513 21:34781324-34781346 ACATTTAAACTGTAGCAGCAAGG + Intergenic
1179200898 21:39219549-39219571 ACGTTTACAATGAGGGAACAAGG + Intronic
1179250946 21:39670838-39670860 GTTTTTAAAATGAGGGTGCATGG - Exonic
1179601136 21:42477500-42477522 ATATTAAAAGTGAGGGAGGAAGG + Intronic
1180561474 22:16618731-16618753 TCATTAAAGATGAGGGAGAAAGG - Intergenic
1180610945 22:17097626-17097648 ACATTAGAGAAGAGGGAGCAGGG + Intronic
1182263493 22:29093632-29093654 ACAGTCAACATGAGGGAGGAAGG - Intronic
1182915073 22:34021936-34021958 GCTTTTAAAAAGAGAGAGCAAGG - Intergenic
1182972708 22:34592797-34592819 ACATTTAAGATTATTGAGCAGGG - Intergenic
1183470449 22:38003084-38003106 ACATGGAAAATTAGGGAGAAAGG + Intronic
1183534178 22:38386291-38386313 TCATTAAAGATGAGGGAGAAGGG + Intronic
1183602593 22:38848660-38848682 ACTTTTAAAAGGGGGGAGGAGGG + Intergenic
1184050958 22:42004290-42004312 AAATTTAAAAAGAAGGAACAAGG + Intronic
1185025846 22:48411500-48411522 ACATGTAAAAGCAGGGAGGAAGG + Intergenic
949532684 3:4972162-4972184 ACTTTTAAAAGGAGTGAGAAGGG + Intergenic
949643451 3:6066548-6066570 ACATGTGGAATCAGGGAGCAGGG - Intergenic
949986681 3:9546632-9546654 ATCTTTAAAATGAGGGAGTTGGG + Intronic
950603989 3:14061849-14061871 ACAATTAAAATGATGGGACATGG - Intronic
950950313 3:16991904-16991926 ATATTTAGATTGAGGGAGGAGGG + Intronic
951729548 3:25795600-25795622 AGATTAACAATCAGGGAGCATGG - Intergenic
951972974 3:28469057-28469079 AAAGTTAAAAAGAGGGAGGAAGG + Intronic
952327044 3:32330314-32330336 CCTTTTAAAATCAGGAAGCATGG - Intronic
952508138 3:34026518-34026540 ACATTTAAAATGAGAAAATATGG + Intergenic
953358195 3:42272182-42272204 ACATCTGAAAAGAGGGAGTATGG - Intergenic
955299638 3:57765049-57765071 ACTTTTAAAAAGAGGAAGAATGG + Intronic
955560560 3:60184702-60184724 ACATTTAAGATGTGAGAGCTAGG + Intronic
955665568 3:61345922-61345944 ACAGTTTAAATAGGGGAGCAAGG + Intergenic
955979440 3:64509913-64509935 ATATTTAAAATGGGTCAGCAGGG - Intergenic
956109666 3:65857845-65857867 ACATTTAAAAAGAGGTAGGAAGG + Intronic
956194822 3:66642734-66642756 ACATTCGAAAGGAAGGAGCAGGG - Intergenic
956353115 3:68360147-68360169 ACATTTAGCATGAGGAGGCATGG - Intronic
957301876 3:78402606-78402628 ACCTTTAAAGTGAGGGGGTAGGG - Intergenic
958097222 3:88962289-88962311 ACATTGACAAGGAGGGTGCAGGG - Intergenic
959260920 3:104078377-104078399 ATATTTAAAATCAGGGAGTCAGG + Intergenic
959702285 3:109309773-109309795 ATATTAAAAATGAGGTAACAAGG + Intronic
959890293 3:111547315-111547337 ATATATAAAAAGAAGGAGCAGGG - Intronic
960281770 3:115788306-115788328 ACATATAAAATGAGAGGGCTTGG + Intergenic
960679528 3:120232873-120232895 ACATTTAAAAGGAAGAAACAGGG - Intronic
960749042 3:120925959-120925981 AAATTCAAAATGAGGGAAGAGGG - Intronic
961057412 3:123800602-123800624 TCCTCTAAAATGAGGCAGCAAGG + Intronic
961998985 3:131275143-131275165 AAATTGAAAGTGAGGGAGTATGG + Intronic
962455951 3:135565775-135565797 ACATTCAAGATGAGTGAGGAAGG - Intergenic
962916376 3:139907683-139907705 ACATTTTAAATGAGGTATTATGG - Intergenic
963721263 3:148864799-148864821 ACATTTAAATTGACTGGGCACGG - Intergenic
966093493 3:176169972-176169994 TCATAGAAAATGTGGGAGCAAGG + Intergenic
966427394 3:179794092-179794114 ACATTTAAAAAGTGGAAGTAGGG + Intergenic
966527879 3:180940429-180940451 ACATGTGAAATGAGGGAGGAGGG - Intronic
967365985 3:188687125-188687147 AAATTGGAAATGAGGGAGCATGG - Intronic
967632862 3:191767365-191767387 ATATTTAAAAAGAGGTTGCATGG + Intergenic
968033446 3:195524218-195524240 ACCTTTAAAAACAGGAAGCAGGG + Intronic
969397028 4:6928535-6928557 ACAGTTAATATGAGGGGGCCGGG + Intronic
969459032 4:7317902-7317924 ACATTTAAATTCCGGGGGCAGGG - Intronic
969936992 4:10692019-10692041 ACATTTAAAAAGAGAGAGGCAGG - Intergenic
970266613 4:14295278-14295300 ACATTTTAAAGGAGGCAGCATGG + Intergenic
970461523 4:16279076-16279098 ACATTTCAAATGGGGGAATAAGG + Intergenic
970579869 4:17465367-17465389 TCCTTTAATAGGAGGGAGCAAGG + Intronic
971871617 4:32247538-32247560 AATTTTAAAATAAGGGATCATGG - Intergenic
972134631 4:35876800-35876822 ACATCCAAAATGTGGGAGGAGGG + Intergenic
972265406 4:37454441-37454463 ATACTTAAAATGGGGGAGGAGGG - Intronic
972633532 4:40862548-40862570 ACAGTTAAAATGATGGTGCCGGG + Intronic
973993309 4:56433530-56433552 ACATTTAAAGGGAAGGAGAAAGG + Intronic
975289531 4:72660700-72660722 CCATTTATATTCAGGGAGCAGGG + Intergenic
975354069 4:73379359-73379381 CAATTTAAAATAATGGAGCATGG - Intergenic
977293048 4:95183719-95183741 ACATAAAAAATGGGAGAGCATGG + Intronic
978648525 4:110971706-110971728 ACATCTATAATGAGAGAGTAAGG - Intergenic
978877563 4:113660162-113660184 ACAATAAAATTGAGGGAGCTGGG + Intronic
980615426 4:135216070-135216092 ACATTTTGAATGTGAGAGCAAGG - Intergenic
980806295 4:137818654-137818676 AAATTCAAAATGGGGGAGAATGG - Intergenic
982035335 4:151340513-151340535 TGATTTAAAGTGAAGGAGCAGGG - Intergenic
982179547 4:152737206-152737228 ATTGTTAAAAAGAGGGAGCAAGG + Intronic
984452233 4:179917196-179917218 ACATAGAAAATGAGGGATAAAGG + Intergenic
986010812 5:3713434-3713456 ACATCTAAAATGTGGGTGGAGGG - Intergenic
986520768 5:8615604-8615626 ACACCTAAAATGAGCCAGCACGG + Intergenic
986950040 5:13071939-13071961 AAATTTACAATCAGGGAGAAAGG + Intergenic
988479092 5:31614463-31614485 AAATGTAAGATGAGAGAGCAAGG + Intergenic
989452128 5:41598662-41598684 GCATTTAAATTGGGGGGGCAGGG + Intergenic
989476146 5:41875400-41875422 ATGTTTAAATTGAGGGAGAATGG - Intergenic
989793470 5:45436856-45436878 ATCTGTAAAATGAGGGAGCTAGG - Intronic
993159336 5:84268452-84268474 ATATTTAAAATGACACAGCAAGG + Intronic
993826096 5:92688683-92688705 ACATTTAAAATGAGTTTACATGG + Intergenic
994080440 5:95703178-95703200 ACATTTGAAATTAGGGAAAATGG + Intergenic
994567846 5:101475011-101475033 ACGTATAATATGAGGGAGAAGGG + Intergenic
995064578 5:107845524-107845546 TCCTTTAAAATGAGGGATAAAGG + Intergenic
995157996 5:108938610-108938632 TCATTGAAAATGATGTAGCATGG + Intronic
995290649 5:110447728-110447750 AGATTTGAAATGAAGAAGCATGG + Intronic
995577265 5:113551924-113551946 ACATATAAGATGAAGAAGCAAGG + Intronic
995883774 5:116870642-116870664 TGATTTTAAATGAGGGATCATGG + Intergenic
996345494 5:122484088-122484110 ACATTTAAAATGAGGAACTTGGG + Intergenic
996413913 5:123188843-123188865 CCATTTAAAATGTGGTAGCTGGG - Exonic
996946266 5:129073095-129073117 AAATTCTAAATGAGAGAGCACGG - Intergenic
997120671 5:131169780-131169802 ACACTGAAAATGGGGGAGCGGGG + Intronic
998058850 5:139103334-139103356 CCTTTTAAAAAGAGGGAGGAAGG - Intronic
998919579 5:147053047-147053069 ACATTCAAAATGACATAGCAGGG - Intronic
1000083288 5:157867523-157867545 ACATTTAAGATGAGAGTGTAAGG + Intergenic
1001349620 5:170947461-170947483 AGATTTAAAATAATGAAGCAAGG + Intronic
1003338051 6:5193534-5193556 TCTTTGAAAATGAGGCAGCAGGG + Intronic
1003343721 6:5246039-5246061 AAAATTAAAAAAAGGGAGCAGGG + Intronic
1003620285 6:7693483-7693505 ACCTTTAAAAGGAAGGATCATGG - Intergenic
1006508849 6:34510616-34510638 AGATCTAAAAAGAGGGAGAAAGG - Intronic
1006745148 6:36336514-36336536 ATCTCTAAAAAGAGGGAGCAAGG - Intronic
1006805500 6:36786033-36786055 AAATTTAAAAAGAAGGACCACGG + Intronic
1009535922 6:64885378-64885400 ACATTTAAAATATCAGAGCAAGG + Intronic
1009552262 6:65113474-65113496 AAATTTAAAACGAGGTAGTATGG + Intronic
1009748208 6:67847736-67847758 ACATTGAATATCAGAGAGCAAGG + Intergenic
1011080043 6:83479854-83479876 ACATATAAAATAAGGAAACATGG - Intergenic
1011082822 6:83508277-83508299 ACTTTTCAAATGAGGGAATAGGG + Intergenic
1011166624 6:84454870-84454892 ACATTTTAAAAGAGGGACAAAGG + Intergenic
1012525698 6:100175349-100175371 AGATTTAGTATGAGGGAGGAGGG - Intergenic
1013396574 6:109746917-109746939 GGATTTGAAATGAGGGAGTAGGG + Intronic
1014100658 6:117508325-117508347 ATATGTAAAATGAGGGAGGGGGG - Intronic
1014342551 6:120228006-120228028 ACACTCAACATGAGGGTGCAGGG - Intergenic
1015305536 6:131702677-131702699 ACATTTTAATTGTGGGATCAAGG - Intronic
1015754246 6:136591705-136591727 ATATTTAAAAGGAGGGTGAAGGG - Intronic
1015906900 6:138126898-138126920 TCATTTAAAATTAGTGACCAGGG - Intergenic
1016622482 6:146128187-146128209 TCATTTAAAGGGAGGGAGCAGGG + Intronic
1016919997 6:149283283-149283305 ACATTGAAAATATGGGAGGATGG + Intronic
1017355087 6:153495206-153495228 TTTTTTAAAATGAGGGAGTATGG - Intergenic
1017930080 6:158944562-158944584 ACATTGAAACAGAGGGAGCATGG - Intergenic
1018306273 6:162459582-162459604 ACATTTAAACTGAGGTAGTCTGG - Intronic
1018590853 6:165420186-165420208 ACATTAACAAGCAGGGAGCAGGG - Intronic
1018833738 6:167467495-167467517 ACACGTAGAATGAGGGAGCACGG - Intergenic
1020628546 7:10612572-10612594 AGATTTAAAATGAGGAAATATGG - Intergenic
1021784143 7:24135613-24135635 ACATTTCAAAAGAGGAAGGAAGG + Intergenic
1022552968 7:31259284-31259306 AGTTTTAAAAGGAGGAAGCAGGG - Intergenic
1023807133 7:43880719-43880741 ACATTTAAAGTGACTCAGCACGG - Intronic
1024780343 7:52840677-52840699 ACATGTAAAATAAATGAGCAAGG + Intergenic
1027861648 7:83590606-83590628 CCAATTAAAATGAGGGATAAGGG + Intronic
1028279751 7:88907672-88907694 ACATTTAAAATGAGGGAGCATGG + Intronic
1029961828 7:104695872-104695894 ATTTAGAAAATGAGGGAGCAAGG - Intronic
1029999730 7:105046776-105046798 ACATTTAAAATTAGATGGCAAGG - Intronic
1031107863 7:117567946-117567968 ACATTTAAGCTGAGAGAGGATGG + Intronic
1031241655 7:119251233-119251255 AAATTTACAATCAAGGAGCAGGG - Intergenic
1031694524 7:124833518-124833540 ACATTTAGAAGGAGGGGGTAGGG - Intronic
1031881262 7:127201156-127201178 ACAGATAAAGTGAGGGAGAAGGG + Intronic
1033739651 7:144260908-144260930 ACATTTTAATTGTGGGATCAAGG - Intergenic
1035988978 8:4466817-4466839 AAATTTAAATTCAGAGAGCAGGG + Intronic
1036704680 8:11038089-11038111 AAATTTGAAATCAGGGATCAGGG - Intronic
1042537559 8:69873920-69873942 CCTATTAAAATGAGGGAACAGGG + Intergenic
1043295325 8:78654573-78654595 GCATTTAAAATGTGGGTCCAGGG - Intergenic
1043450754 8:80363857-80363879 ACATTTAGAAAGAGGAAGCATGG - Intergenic
1043852291 8:85228846-85228868 ATATTTCAAATAAGGGAGCCAGG - Intronic
1044858683 8:96500288-96500310 TCATTTAGAATGAGGTGGCAGGG + Intronic
1044874156 8:96647803-96647825 ACATTTAAAATTAAGATGCATGG - Intronic
1045539143 8:103065620-103065642 AAATTTAAAAATAGTGAGCATGG - Intronic
1047665625 8:127087674-127087696 ACATGTAAAAAAAGGGGGCATGG + Intergenic
1049144552 8:140989238-140989260 AAATTTAAAATTAGCCAGCAGGG + Intronic
1050228971 9:3496669-3496691 ACATTAAAAATCTGGGATCAAGG + Intronic
1050267960 9:3910870-3910892 ACATGTTATATGAGAGAGCAGGG - Intronic
1051342586 9:16125640-16125662 ACTTTTAAAATGAAGGAGTTGGG + Intergenic
1052097479 9:24401261-24401283 AAATTTATAATGAGTTAGCAAGG - Intergenic
1052351352 9:27461500-27461522 AAGATTAAAATGAGGCAGCAAGG - Intronic
1052587608 9:30449391-30449413 TCATGAAAAATGAGGGAGGAGGG - Intergenic
1054752502 9:68922162-68922184 ACATTTTAAAAGATGTAGCAGGG + Intronic
1055043405 9:71899680-71899702 ACATTAAAATTGAGGCAGTAGGG - Intronic
1055318873 9:75062739-75062761 ACATTTAAAAAGGCTGAGCATGG + Intronic
1055560539 9:77517306-77517328 TCATTCAAAAATAGGGAGCAAGG + Intronic
1056130048 9:83575510-83575532 ACATTTATAAGGAGTGAGCTGGG - Intergenic
1058138290 9:101331678-101331700 ACATATAAAAAGAAAGAGCAAGG + Intergenic
1058151592 9:101469463-101469485 ACACTTACCTTGAGGGAGCAAGG + Intergenic
1059062886 9:111052206-111052228 AAATTTAGATTGAGAGAGCATGG + Intergenic
1059300580 9:113309762-113309784 ATGTTTAAAATGAGGCTGCATGG - Intergenic
1059549990 9:115219402-115219424 GCATTTAGAATCTGGGAGCAGGG - Intronic
1060230774 9:121823578-121823600 ACTTTTATAATCAGGGAACAAGG + Intronic
1060394289 9:123304620-123304642 AAATTTAAAAAGAGAGAGGAAGG - Intergenic
1061243813 9:129390986-129391008 ACATAGTAAATGGGGGAGCAGGG + Intergenic
1061462555 9:130751889-130751911 ACATTTAAACTGTAGGTGCAGGG + Intronic
1186121830 X:6371621-6371643 AGATATAAAAGGAGGGAGTAGGG - Intergenic
1186819195 X:13269267-13269289 ACCTGTAAAATGAGGGGGCTTGG + Intergenic
1188398326 X:29713909-29713931 ACATTTAAAATGATAGAACTAGG + Intronic
1189544719 X:42029586-42029608 ACATTTATCATGAGGGAGAGGGG - Intergenic
1192557697 X:72103500-72103522 ACATTTAGAATCTGGTAGCAAGG + Intergenic
1193732627 X:85119367-85119389 ACCTTTAAAATGATTGAGCCAGG + Intergenic
1195043074 X:101031992-101032014 ACATAGAAAATGAGGGAGAGGGG + Intronic
1195642010 X:107185897-107185919 ACATTTAACAAAAGGGAGTAGGG + Intronic
1195642923 X:107196967-107196989 ACATTTAAAATGACACAGAAAGG - Intronic
1196536031 X:116845513-116845535 AGATTTAGTATTAGGGAGCAAGG + Intergenic
1196605778 X:117655567-117655589 AAATTTAAAATGATGGTGGAAGG + Intergenic
1196657211 X:118230985-118231007 ATAGTGAAAATGAAGGAGCATGG + Intergenic
1196923764 X:120611354-120611376 TCATTTAAATTGGGGGAGGAGGG + Intronic
1197018615 X:121658629-121658651 ATATTTAAAATGAGGGAGTTTGG - Intergenic
1197292959 X:124682586-124682608 ACATTTAAAGTGAAGAAGCCTGG + Intronic
1197918516 X:131562472-131562494 ATCTTTAAAATGAGGGAGGTTGG - Intergenic
1199049461 X:143220138-143220160 ACCCTTAAAAGGAGGGAACAGGG - Intergenic
1199290578 X:146100683-146100705 AAATATAAAAGGAGGGAGAAAGG + Intergenic
1199936569 X:152580158-152580180 GGATTTATAATCAGGGAGCAGGG - Intergenic
1201480752 Y:14437116-14437138 AAATTCAATATGAGGGAGAAAGG - Intergenic
1202591778 Y:26492725-26492747 TCATTAAAGATGAGGGAGAAGGG - Intergenic