ID: 1028280818

View in Genome Browser
Species Human (GRCh38)
Location 7:88925749-88925771
Sequence GAGAGTAGAAAGGATGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 409}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028280813_1028280818 12 Left 1028280813 7:88925714-88925736 CCGGCTTTGTAGGAGCAGGTGTG 0: 1
1: 0
2: 0
3: 18
4: 146
Right 1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG 0: 1
1: 0
2: 1
3: 33
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028280818 Original CRISPR GAGAGTAGAAAGGATGGTGC AGG Intronic
900812370 1:4816630-4816652 GAGATTAGAAATGATGGTTTAGG + Intergenic
901640031 1:10688473-10688495 GAGTCTAGAAAGCATGGTGGCGG + Intronic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
902375331 1:16027640-16027662 GAGGGTAGAAGGGATGAGGCTGG + Intronic
902380294 1:16049437-16049459 GAGGGTAGAAGGGATGAGGCTGG + Intronic
902664456 1:17927753-17927775 GTGAGTGGATAGGTTGGTGCTGG + Intergenic
902940115 1:19794954-19794976 GAAAGTAGAATGAATGGTGGTGG + Intronic
903229780 1:21914749-21914771 GGGAGGAGAAAGGATGGTGCTGG + Intronic
903892400 1:26578458-26578480 GAGAGCAGACTTGATGGTGCTGG + Intergenic
903973840 1:27136663-27136685 GAGAGTGGAGAGGATGTAGCCGG - Intronic
904442260 1:30539550-30539572 GAAAGTAGAAAGGGGGTTGCGGG - Intergenic
904901916 1:33864477-33864499 AAGAGTAGGAAGGATGATGGAGG - Exonic
905475573 1:38224855-38224877 GAGATTAGAAATGATGGTTTAGG - Intergenic
906012748 1:42544216-42544238 GGGAGTAGAAAGGATGGGTGGGG - Intronic
906030766 1:42718321-42718343 GAGAGTAGATGGCATGGGGCAGG - Intergenic
908634152 1:66143805-66143827 TCGAGTAGAAAGAAGGGTGCAGG - Intronic
909321257 1:74288585-74288607 GAGAGTAGAATGGTGGTTGCCGG + Intronic
910521590 1:88127958-88127980 GGGAGCAGAAAGGCTGGGGCTGG - Intergenic
910700058 1:90063754-90063776 GAGAGGAGAGAGGATGATGGAGG + Intergenic
911267877 1:95764287-95764309 GAGAGTAGAAGGGGTGGGGAGGG + Intergenic
913974983 1:143448945-143448967 GAGAGAAGAGAGTATGGTGCTGG - Intergenic
914069375 1:144274561-144274583 GAGAGAAGAGAGTATGGTGCTGG - Intergenic
914109780 1:144691793-144691815 GAGAGAAGAGAGTATGGTGCTGG + Intergenic
914870553 1:151470409-151470431 GAGAGTTGAAAGGAGGTTGAGGG - Intergenic
914953721 1:152143351-152143373 GAGAGTAGAATGGTGGCTGCTGG - Intergenic
915386475 1:155498297-155498319 TAGAGAAGAACGGATGGTGAGGG + Intronic
915581635 1:156816434-156816456 GAGAGGAGAGAGGAGGGAGCAGG - Intronic
916632887 1:166635936-166635958 GAGAGAAAAAAAGATGCTGCTGG - Intergenic
917213729 1:172657034-172657056 GGGAGTAGCGAGGATGGGGCAGG + Intergenic
918755110 1:188330590-188330612 GAGAGTAGAAAGGTGGTTACTGG - Intergenic
918973900 1:191455565-191455587 AATAGTAAAAAGGATGGTGTGGG - Intergenic
919531644 1:198728903-198728925 GAGAGGAGAGAGGAGGGTGAGGG - Intronic
920180885 1:204131156-204131178 GAGGGTAGAAAGGGAGGTGGAGG + Exonic
920306253 1:205020062-205020084 CAGAGCACAAAGGAGGGTGCTGG - Exonic
920689788 1:208137168-208137190 AACAGCAGAAAGGATGGTGATGG - Intronic
920949491 1:210558857-210558879 GAAATTAAAAAGGAAGGTGCGGG + Intronic
921460174 1:215415784-215415806 GAGAGTAGGAAGGGAGCTGCTGG - Intergenic
921462805 1:215448861-215448883 GAGAGTAGGAAGGGAGCTGCTGG + Intergenic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
922751085 1:228070325-228070347 TAGTGTAGAAAGGATAGTGTAGG + Intergenic
923204850 1:231749164-231749186 GAGTGTTGAAGGGAGGGTGCTGG - Intronic
924101172 1:240604070-240604092 GAGAGAAGGAAGGGAGGTGCCGG + Intronic
1063187135 10:3661655-3661677 CAGAGAAGAGAGGCTGGTGCGGG + Intergenic
1065005443 10:21375634-21375656 GAGAGCACAAAGGATGGTGAAGG - Intergenic
1065187028 10:23178449-23178471 CAGAGAAGAAAGGAAGGTACAGG - Intergenic
1065413167 10:25452902-25452924 GAGAGTAGAATGGTGGCTGCAGG - Intronic
1067247900 10:44561514-44561536 GAGACTTGAAAGTATGGGGCAGG - Intergenic
1069169025 10:65201687-65201709 GAGAGAAGAAAGGATACTCCTGG + Intergenic
1069555705 10:69396518-69396540 GAGAGTAGAATGGTGGTTGCTGG - Intronic
1070085483 10:73232974-73232996 TCGAGTTGAAAGGATGGTACTGG - Exonic
1072190229 10:93072218-93072240 GAGAGTCGCTAGGATTGTGCGGG + Intergenic
1072272297 10:93788421-93788443 GAGATAATCAAGGATGGTGCAGG - Intronic
1073834409 10:107424627-107424649 GAGACTAGAAAGGGTGCTGGTGG + Intergenic
1074783755 10:116820929-116820951 GAGAGGAGTAAGGATGATGCTGG - Intergenic
1075321912 10:121498283-121498305 GCCAGTGGAAAGGAGGGTGCAGG - Intronic
1075532724 10:123243654-123243676 GAGACTAGAAAGCAGGATGCTGG + Intergenic
1076077317 10:127544852-127544874 GAGAGTTGGAAGGATGGAGGGGG - Intergenic
1076439297 10:130469522-130469544 GAGAGTAGCATTGATGGTGGTGG - Intergenic
1078748151 11:14135079-14135101 TAGAGTAGAAAGGACTGTTCTGG - Intronic
1078805238 11:14693155-14693177 GAGAGAAGTAAGGAAGCTGCAGG + Intronic
1079064425 11:17276926-17276948 CAGAGCAGAGAGGATGGTGGGGG + Intronic
1081756008 11:45545038-45545060 GAGAGGAGGGAGGGTGGTGCGGG - Intergenic
1081840304 11:46195805-46195827 GGCATTAGAAAGGATGATGCAGG - Intergenic
1082088160 11:48067131-48067153 GAGAGAAAAAAGGAAGGGGCGGG - Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1084704491 11:70807977-70807999 GAAAGTAGAATGGCGGGTGCCGG + Intronic
1086993557 11:93331134-93331156 GAGAGGAGCAGGGATGGTGAAGG - Intronic
1087204844 11:95383614-95383636 GCGAGTAGAAATGAAGGTGAGGG - Intergenic
1087239293 11:95757340-95757362 GAGAGTAGAATTGCTGGTGGTGG + Intergenic
1087267587 11:96077519-96077541 GAGAGTAAAAAAGATGGGGTAGG - Intronic
1087666374 11:101053672-101053694 GAGAGAAGAAAGGAGGGAGAAGG - Intronic
1089194404 11:116685608-116685630 GAGAGCAGAGAGGATGGTAAAGG - Intergenic
1089365184 11:117917147-117917169 GTGAGTTGAATGGAGGGTGCAGG - Intronic
1089923469 11:122232223-122232245 GAGTGTAGAAATGTTGGTGCAGG - Intergenic
1091186782 11:133654591-133654613 GAGAGTAGAAACTATTTTGCAGG + Intergenic
1091280830 11:134380640-134380662 CAGAATAGAAAGGAGGGTGATGG + Intronic
1091320244 11:134644466-134644488 GAGAGTAGAAAGAAGAGTGAAGG - Intergenic
1091911160 12:4231692-4231714 GAGAGTGTAAAAGATGTTGCTGG - Intergenic
1092138948 12:6169517-6169539 GAGAGGAGAAAGGACAGGGCAGG - Intergenic
1092306069 12:7302423-7302445 AACAATAGAAAGGAGGGTGCAGG - Intergenic
1092473458 12:8798427-8798449 GAGAGTAGAATGGTGGTTGCAGG - Intergenic
1095622954 12:44280440-44280462 CACAGTAGAAAGGATACTGCAGG - Intronic
1095829651 12:46570319-46570341 GAGTGTTGAAAGGAGAGTGCTGG - Intergenic
1096977010 12:55705242-55705264 GGGACTAGAGAGGATGCTGCTGG - Intronic
1098523531 12:71460743-71460765 GAGAGGAGGAAGAATGGGGCTGG - Intronic
1098651864 12:72980849-72980871 GTGAGAAGAGAGGATGGTGGAGG - Intergenic
1098950325 12:76634276-76634298 AAGAGGAAAAAGGATGGTTCTGG - Intergenic
1099234173 12:80062521-80062543 GCAGGTAGAAAGGATGTTGCAGG - Intergenic
1101059842 12:100959331-100959353 GAGAGGAAAAATGATGATGCAGG - Intronic
1101329217 12:103743975-103743997 GAGATTAGAAAGGATGGCTCTGG + Intronic
1103795387 12:123499649-123499671 GAGAGTGGAGAGGATGAGGCTGG - Intronic
1104572183 12:129934945-129934967 GAGAGTGGAATGGGTGGGGCAGG + Intergenic
1105516268 13:21093704-21093726 GAGAGAAGAATGCATAGTGCAGG - Intergenic
1105623823 13:22093986-22094008 GGGTGGAGAGAGGATGGTGCTGG + Intergenic
1106086995 13:26551608-26551630 GAGAGTACAGAGGCTGGTGTAGG + Intergenic
1106945690 13:34824983-34825005 GAGAGTAGAAAGGAGAATGGTGG - Intergenic
1107237323 13:38187453-38187475 GAGAGAAGAGAGATTGGTGCTGG + Intergenic
1107543760 13:41417537-41417559 GAGAGTAGTCAGGAGTGTGCGGG + Intergenic
1107575938 13:41722672-41722694 GACAGTAGAAATGGTGATGCTGG + Intronic
1108001520 13:45909523-45909545 GAGCCTAGAAAGTATGGTGAGGG + Intergenic
1110173949 13:72534654-72534676 TAGGGTAGAGAGCATGGTGCAGG - Intergenic
1111112995 13:83739781-83739803 GAGAGTCGAAAGGCTGAGGCAGG - Intergenic
1111234591 13:85392127-85392149 TAGAGTAGAAAGATTGGTGAAGG + Intergenic
1111781245 13:92727812-92727834 GACAGAATAAAGGATGGTGAAGG - Intronic
1112434754 13:99383889-99383911 GAGAGTAGAGAGGCAGGTGGGGG - Intronic
1112819465 13:103314514-103314536 TGGAGTAGAAAAGATGGTTCAGG + Intergenic
1113531921 13:111033443-111033465 GAGAGAAGAAAGGATGGGAGAGG + Intergenic
1114398922 14:22391711-22391733 GAGATTAGAAAGCATGGTGGTGG - Intergenic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1120080479 14:80210969-80210991 GGGAGTAGAAGGCATTGTGCTGG - Intronic
1120307149 14:82785212-82785234 GAGAGGAGAAAGGCTTGGGCAGG + Intergenic
1121941861 14:98078474-98078496 GATAGCATAAAGGATGCTGCAGG + Intergenic
1124010835 15:25837464-25837486 CAGAGTAGAAAGGAGGCTCCCGG + Intronic
1124721653 15:32115788-32115810 GAGAGAGGAAGGGAGGGTGCAGG + Intronic
1124807144 15:32896586-32896608 GAAAGTAGAATGAATGATGCGGG - Intronic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1128934372 15:71732847-71732869 CAGAGAAGAATGGATGGGGCGGG - Intronic
1129060549 15:72857201-72857223 GAGAGTAGAAAGAAAAGTGAAGG + Intergenic
1129110838 15:73336103-73336125 GTGAGTAGAGAGGCTGGTCCAGG + Intronic
1129491139 15:75926723-75926745 GAGAGAAGGAAGGATGGGGAAGG + Intronic
1131838444 15:96412914-96412936 GAGAGTAGAAAGCAGAGTGAGGG + Intergenic
1131870435 15:96758146-96758168 TCGAGTTGAAAGGATGGTACTGG - Intergenic
1132666987 16:1085740-1085762 GAAAGTAGAAGGGCAGGTGCCGG - Intergenic
1133435123 16:5772611-5772633 GTGAGTTGAAAGGATGGTGGCGG + Intergenic
1134815856 16:17205386-17205408 GGGAGGAGAAAGCAAGGTGCAGG + Intronic
1135108868 16:19674733-19674755 GAGAGTAGAATGGTGGTTGCAGG - Intronic
1135807249 16:25554053-25554075 GAGAGGAGAAAGGAAGAAGCTGG - Intergenic
1136100723 16:27993633-27993655 GAGAGGAGAAAGGAAGAAGCTGG + Intronic
1137710355 16:50562721-50562743 GAAAGGAGAGAGGAGGGTGCAGG + Intronic
1137959995 16:52873185-52873207 GGAAGTAGGAAGCATGGTGCAGG + Intergenic
1138086277 16:54136478-54136500 GAGATTAGCCAGGATGCTGCTGG - Intergenic
1139127795 16:64101165-64101187 GAGGGGAAAAAGGATGATGCTGG + Intergenic
1140953757 16:79843756-79843778 GAGAGTAGGAGGGATGAGGCAGG - Intergenic
1141790853 16:86233093-86233115 GAGAGTAGAATGGCAGTTGCCGG + Intergenic
1143282790 17:5767153-5767175 GAGAGTCGAAAGGCGGATGCAGG - Intergenic
1143739336 17:8941219-8941241 GAGAGTAGGGAGGCAGGTGCAGG + Intronic
1143940458 17:10535616-10535638 CAGGGTAGAAAGGATGGTGTTGG - Intronic
1144161424 17:12564169-12564191 GAGGGAAGAGAGGCTGGTGCTGG + Intergenic
1144282962 17:13745102-13745124 GAGGGAAGAAGGGATGGGGCTGG - Intergenic
1144337431 17:14284141-14284163 GAGAGTAGAATGGGGGTTGCCGG + Intergenic
1144350922 17:14395496-14395518 GATAGTAGTAATGATGTTGCAGG + Intergenic
1144913391 17:18701716-18701738 GTGTGGAGAAAGGATGGTGGGGG + Intronic
1145197073 17:20903113-20903135 GAGAGTAGAATGGAGGTTACCGG - Intergenic
1145877789 17:28332862-28332884 GAGAGGAAAAAGAATGGAGCTGG + Intronic
1146381833 17:32336085-32336107 GAGAGAGGAAGGGATAGTGCAGG - Intronic
1146970042 17:37065252-37065274 CACAGGAGAAAGGACGGTGCTGG - Intergenic
1148088907 17:45010830-45010852 GAGAGGAAGAAGGATGTTGCAGG + Intergenic
1148649871 17:49242498-49242520 GAGATTAGAAATTATGGTTCAGG - Intergenic
1148653116 17:49263857-49263879 TCCAGTAGAAAGGATGGGGCGGG - Intergenic
1148903398 17:50895521-50895543 GACAGTAGACAAGATGGGGCAGG - Intergenic
1149080444 17:52650202-52650224 GAGAGAAGAAAGGACTGAGCTGG + Intergenic
1149400451 17:56290574-56290596 CCAAGTAGAAAGGATGGTGGGGG - Intronic
1149730721 17:58943561-58943583 GAGGGTAGAAAGGAAGGAGGAGG - Intronic
1151035021 17:70788899-70788921 GATAGTGGAAATGATGGTGATGG + Intergenic
1151737990 17:75957634-75957656 GAGAGTTTAAAGGACTGTGCAGG - Intronic
1152753745 17:82078318-82078340 GAGGGAAGAAAGGACGGTGGTGG + Exonic
1153671203 18:7414248-7414270 GAGAGTAGAATGGCTGGGGCAGG - Intergenic
1154316489 18:13308133-13308155 GAGTGTCGAAAGCATGGTACAGG - Intronic
1155275895 18:24187204-24187226 GAGAGTAGAATGGTGGTTGCCGG + Intronic
1156591237 18:38490967-38490989 GTCAGTGGCAAGGATGGTGCTGG - Intergenic
1156918113 18:42485380-42485402 GAGAATGGAAGGGATGGTGGGGG + Intergenic
1157570082 18:48706433-48706455 GTGAGCAGAAAGCATTGTGCCGG - Intronic
1157799913 18:50610633-50610655 GAGACTAGAAGGGATCGTTCAGG + Intronic
1159078554 18:63709142-63709164 AAGAGAAGAAAAGATGATGCTGG - Intronic
1159248033 18:65835441-65835463 TAGAGGAGAAAGGATGATGAGGG - Intronic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1160341764 18:78095334-78095356 TAAAGAAGAAAGGATGCTGCAGG - Intergenic
1160690892 19:460410-460432 GAGAGCAGGAAGGATGGGGAGGG + Intronic
1160815252 19:1032473-1032495 GAGCGGAGCAGGGATGGTGCTGG + Intronic
1162271296 19:9618114-9618136 AAAGGTAGAAAGGATGGTGGAGG - Exonic
1162440349 19:10688521-10688543 GAGAGAAGACAGGATGGTTAAGG - Intronic
1163116266 19:15190571-15190593 GAGAGAAAAAAAGATGATGCTGG - Intronic
1164432224 19:28198445-28198467 GAGAGTGGGAAGGATTTTGCAGG - Intergenic
1165618074 19:37219571-37219593 GAGAGAAGAAGGGATGGGGGAGG - Intronic
1166546809 19:43639184-43639206 GAGAATAGACAGGATGATGGAGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166981271 19:46633654-46633676 GAGAGGAGAGAGGATGGCGGAGG + Intergenic
1167154399 19:47729508-47729530 GAGAGGAGAAAGGAGAGCGCGGG + Intronic
1167282147 19:48575888-48575910 GAGAGTAGGGAGGTGGGTGCTGG - Intronic
1168348448 19:55662059-55662081 GAAAGTAGAAAGGAAGTGGCAGG - Intronic
925641575 2:5990395-5990417 GAGCCAAGAAAGGATGGTGGGGG - Intergenic
925860018 2:8165568-8165590 ATGAGGAGAAAGGAAGGTGCAGG + Intergenic
925910074 2:8568061-8568083 GAGAGGGGAAAGGAGGCTGCTGG + Intergenic
926214813 2:10898461-10898483 GAGATTAGGAAGGGAGGTGCTGG - Intergenic
926301225 2:11604472-11604494 GAGAGAAGAGAGGATGATGATGG - Intronic
926442781 2:12907582-12907604 TACAGTAGAAAGAATGGTGGGGG - Intergenic
927463107 2:23316293-23316315 GGGAGAAGTAAGGATGGTCCAGG + Intergenic
927879912 2:26683004-26683026 GAGAGTAAAACAGAAGGTGCTGG - Intergenic
928712511 2:34023167-34023189 GAGAGGAGAAAGAATGGATCAGG + Intergenic
929850972 2:45590396-45590418 AAGAGTAGAAATTATGGTTCAGG + Intronic
929917213 2:46146008-46146030 GTGAGTACACAGGATGGAGCAGG + Intronic
929919131 2:46160203-46160225 GGCAGCAGGAAGGATGGTGCTGG + Intronic
930357700 2:50343162-50343184 GGGAGGAGAAAGGATGGCACTGG + Intronic
930790482 2:55321841-55321863 GAAAGTAGAAATCATGGTGTGGG + Intronic
932538935 2:72630453-72630475 GAGTGTAGAGAGGATAATGCAGG - Intronic
933292406 2:80452635-80452657 GGGAGAAGAAAGGATGCTGGTGG + Intronic
933360495 2:81276768-81276790 GAGAGTAGAATGGTGGTTGCTGG + Intergenic
933709667 2:85315973-85315995 GAGGGCAGAAAGGGTGGGGCAGG - Intergenic
933713401 2:85343801-85343823 GAGGGCAGAAAGGGTGGGGCAGG + Intronic
934179687 2:89609918-89609940 GAGAGAAGAGAGTATGGTGCTGG - Intergenic
934289977 2:91684179-91684201 GAGAGAAGAGAGTATGGTGCTGG - Intergenic
934724471 2:96606546-96606568 CAGAGTAGGAAGGAGGGTGTAGG + Intronic
934747558 2:96769589-96769611 GAGAGAGGAAAGGACAGTGCAGG + Intronic
935105992 2:100044215-100044237 GAGGGTAGAATGGAGGATGCGGG - Intronic
935344434 2:102092766-102092788 AAGAGAAGAAAGGATGGGGGTGG + Intronic
935782610 2:106521258-106521280 GGGAGCAGAAAACATGGTGCCGG - Intergenic
938139399 2:128783674-128783696 GAGAGTGGAAACCATGGTGGGGG - Intergenic
938374834 2:130798362-130798384 GAGACTTGGAACGATGGTGCAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938981436 2:136530890-136530912 CAGAGTTCCAAGGATGGTGCAGG + Intergenic
939798242 2:146674949-146674971 GAAGGTAGAAAGGATGATGGAGG - Intergenic
939961223 2:148567681-148567703 GAGAAGAGAAAAGATGGGGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942172383 2:173300736-173300758 GAGAGTAGAAAGGAAGAAACTGG - Intergenic
942312083 2:174665371-174665393 GAGAGTGGAGAAGATGGTGATGG - Intronic
943434528 2:187848062-187848084 TTGAGTAGAAGGGGTGGTGCAGG - Intergenic
943873346 2:193030537-193030559 GAGACTAGGAAGGATAGTGGAGG + Intergenic
943984485 2:194602833-194602855 AAGAGCAGACAAGATGGTGCTGG + Intergenic
944417513 2:199493448-199493470 GAGAATAGACAGTATGGAGCTGG + Intergenic
944913351 2:204332008-204332030 GAGTTTAGAAAGGATGGAGATGG - Intergenic
945309043 2:208289033-208289055 CAGAAGAGAAAGGATGGTGTAGG - Intronic
945506069 2:210641608-210641630 GAGAGTAGACAGGTAGATGCTGG - Intronic
945726539 2:213477131-213477153 GAGAGTAGATAAGATGGGGATGG + Intronic
945789417 2:214286142-214286164 GAGAGTAGAATGGTGGTTGCTGG + Intronic
947827064 2:233113731-233113753 GAGAGAGGCAAGGATGGAGCTGG - Intronic
948421989 2:237865346-237865368 GGGAGTAGAGAGGAGAGTGCAGG + Intronic
948756970 2:240165617-240165639 GTGAGGAGAAAGGAAGGGGCTGG + Intergenic
949056545 2:241931110-241931132 GAGAGTAGAGAGAACGGTCCAGG + Intergenic
1168853716 20:994127-994149 GTGAGTAGACATGAGGGTGCAGG - Intronic
1169347718 20:4841920-4841942 GAAAGTAGAATGGCTGTTGCTGG - Intergenic
1169605690 20:7316289-7316311 AAGAGTAGAAGGGATGCTACTGG - Intergenic
1170588962 20:17756649-17756671 GAGAGTAGAAATGATTCTACAGG + Intergenic
1170621606 20:18001116-18001138 GTGAGGAGAAAAGATGGGGCTGG - Intronic
1171779375 20:29405422-29405444 GAGACTGGAAAGGAGGTTGCAGG - Intergenic
1173837429 20:46135041-46135063 GAAAGCAGGAAGGAGGGTGCGGG - Intergenic
1175217650 20:57400020-57400042 GAGAGAAGTACAGATGGTGCTGG - Intronic
1176753359 21:10707835-10707857 TGGAGTAGAAAGGATTGTGGTGG - Intergenic
1177750268 21:25273178-25273200 GAGAGTAGGAAGGAGGTTACAGG + Intergenic
1178682999 21:34688972-34688994 GAGATTAGAAAGGAAGATCCTGG - Intronic
1178758407 21:35376019-35376041 GAGAGTAGAAAGGTGGTTGCCGG - Intronic
1181388374 22:22560508-22560530 GAGAGGAGAGAGGATTGTGGAGG + Intronic
1181516324 22:23415607-23415629 GGGAGTGGGAGGGATGGTGCTGG - Intergenic
1181672522 22:24432390-24432412 GAGAGTTGACGGGATGGAGCAGG + Intronic
1183016145 22:34989266-34989288 GAGAGGAGAAAGGAAGCAGCAGG - Intergenic
1183301084 22:37059517-37059539 GAGAGGTGGAGGGATGGTGCAGG - Intronic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184115122 22:42417738-42417760 GAATGTGGATAGGATGGTGCAGG + Intronic
1184443954 22:44536273-44536295 GAGAGAAGAAAAGATCGTGGGGG - Intergenic
1184599738 22:45536237-45536259 GAAAGTAGAATGGAAGGTGCCGG + Intronic
949868290 3:8565341-8565363 GGAAGTAGAAAGGCTGGAGCTGG + Intronic
950011729 3:9728919-9728941 GAGACTGGAAAGGAGGGAGCAGG - Intronic
950460888 3:13121708-13121730 GAGAGCAGAGAGAATGGGGCAGG + Intergenic
950532828 3:13562809-13562831 GAAAGTAGAATGGTGGGTGCAGG - Intronic
951073871 3:18365621-18365643 GTGAGTAGAAAAGATGGTAAGGG + Intronic
952167135 3:30762747-30762769 GAGAGTGGGAAGGATAGTGGGGG - Intronic
953168672 3:40488000-40488022 CAGAGGAGAGAGGATGGCGCAGG - Exonic
954613712 3:51959141-51959163 GAGAGTGGAAATGGTGGGGCGGG - Intronic
954652166 3:52171859-52171881 GAGAAGAGAAAGGGTGGTTCGGG + Intergenic
955094647 3:55785291-55785313 GAGAAATCAAAGGATGGTGCTGG - Intronic
955672406 3:61415676-61415698 GAGAGTAGAAGTCATGGTTCAGG - Intergenic
956145662 3:66188503-66188525 GAGAGTAGAAGGGGAGGTACCGG - Intronic
956219473 3:66886595-66886617 GAGAGGAGAGAGGATGGTGAGGG + Intergenic
957085769 3:75675230-75675252 GAGACTGGAAAGGAGGCTGCAGG + Intergenic
959265920 3:104138615-104138637 GAGAGTAGAAATAATTGGGCAGG - Intergenic
959555550 3:107713046-107713068 GAGAGTAGAAAGATCAGTGCTGG - Intronic
960635837 3:119783360-119783382 CAGAGTTGAAAGGATGTTGTAGG - Intronic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
962776010 3:138660539-138660561 GAGAGTAGAATGGTGGCTGCAGG + Intronic
964728447 3:159839684-159839706 GTGGGTAGGAAGGATGATGCCGG + Intronic
966503991 3:180678980-180679002 GAGAGAGGAAAGGCTGGTTCCGG - Intronic
966649021 3:182278083-182278105 GAGAGGAGAAAGGGTGGTATTGG + Intergenic
966886148 3:184379193-184379215 AAGATTAGGAAGGAGGGTGCTGG + Intronic
967320048 3:188185984-188186006 GAGAGAAGAAAAGCTGGTGTAGG + Intronic
967363284 3:188656512-188656534 GTGAGCAGAAAGGTTGTTGCTGG - Intronic
967903296 3:194479080-194479102 GAGATTAGAAAGGATTGGGGCGG + Intronic
967915528 3:194575527-194575549 GAGATTAGAAATGATGGTTTAGG - Intergenic
968446011 4:652386-652408 GAGAGTGGAAAGGGGGTTGCAGG + Intronic
968479687 4:827580-827602 GAGAGAGGAAGGGACGGTGCTGG - Intergenic
968870693 4:3240579-3240601 GAGAGAAGGGAGAATGGTGCCGG - Exonic
968909923 4:3472532-3472554 GAGAGCAGAGAGGACGGCGCAGG - Intronic
969056108 4:4403869-4403891 GAGAGTATAAAGTCTGGTGGGGG + Intronic
969655199 4:8493156-8493178 GAGATTAGAAATTATGGTGTAGG + Intronic
969829592 4:9783702-9783724 GAGAGAAGAGAGTATGGTGCTGG + Exonic
970078456 4:12252201-12252223 GAGAGGAGAAAGGAGTGTGATGG - Intergenic
970235194 4:13951868-13951890 GCGAGTGGAAGTGATGGTGCTGG - Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
977528488 4:98172885-98172907 GAGATTGGAAGGGAGGGTGCTGG - Intergenic
977631750 4:99250689-99250711 GAGACTGGAAAGGGTGGTGAGGG + Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
978161284 4:105551730-105551752 GAAAGTAGAAAGGATAGGGCAGG - Intergenic
978950446 4:114552479-114552501 GAGATTAGAAATTATGGTCCAGG + Intergenic
979198015 4:117942812-117942834 GATAGGAGAAAGGATGGTGGTGG - Intergenic
980184047 4:129439336-129439358 GAGACGTGAAATGATGGTGCCGG - Intergenic
980619043 4:135273054-135273076 TGGAGTAGAAAGCATGATGCTGG - Intergenic
981368164 4:143927517-143927539 GAAAGTAGAATGGTTGTTGCGGG - Intergenic
981377957 4:144037792-144037814 GAAAGTAGAATGGTTGTTGCCGG - Intergenic
982625641 4:157762576-157762598 GTGAGTAAAAAGGATGGTGGAGG + Intergenic
983164336 4:164456920-164456942 CATTGGAGAAAGGATGGTGCTGG + Intergenic
983950702 4:173637616-173637638 GTGAGTAGAGAAGATGTTGCTGG - Intergenic
984902778 4:184599836-184599858 GAGATTAGAAATGATGGTTTAGG + Intergenic
985431077 4:189881085-189881107 CAGAGGAGAAATGATGATGCAGG + Intergenic
986202878 5:5594654-5594676 GAGAGTAGAATGGTGGTTGCTGG + Intergenic
986266054 5:6191234-6191256 GAGACCAGAGAGGATAGTGCAGG - Intergenic
986854795 5:11855894-11855916 GAGAGAATAAAGGATATTGCCGG + Intronic
990131213 5:52587417-52587439 GACAGTAGAATGGTTGTTGCAGG - Intergenic
990780701 5:59358767-59358789 AAGAGTAGAAGGGATGTTGCTGG + Intronic
992126180 5:73644432-73644454 GAGTGGAGTATGGATGGTGCTGG - Intronic
992743337 5:79795533-79795555 GAGACTAGAAGTGAGGGTGCAGG - Intronic
993213600 5:84989130-84989152 TAGAATAGAGAGGATGGTGCGGG - Intergenic
994190431 5:96863088-96863110 GAGACTTGAGAGGATAGTGCAGG - Intronic
995445977 5:112244450-112244472 GAGAGAAGAAAGGAGGGAGGAGG + Intronic
995590707 5:113696881-113696903 GAAAGTAGAAAGGAATGTGGCGG + Intergenic
995847467 5:116509628-116509650 GCGATTAGGAAGGATGGTACAGG + Intronic
996316008 5:122161412-122161434 GAGAGTAGAAAGGAAGGATAAGG + Intronic
996533963 5:124556675-124556697 GAGAATAGAAAGTATGGAGAAGG + Intergenic
996614897 5:125429554-125429576 GAGAGAAGAAAGAATGCTGATGG + Intergenic
996790550 5:127289634-127289656 GAGAGTAAAGAGGATGGTGAGGG + Intergenic
998595113 5:143521405-143521427 CAGAGTAGAAAAGAAGGTCCAGG - Intergenic
999201122 5:149816986-149817008 GACACTAGAAAGGCTGGTGGAGG - Intronic
999328157 5:150656374-150656396 GAGAGCAGAGAGGGTGGGGCAGG - Intronic
999578166 5:153003994-153004016 AAAAATAAAAAGGATGGTGCGGG + Intergenic
999679945 5:154047436-154047458 AAGAGTAGAAAGGAAGGAGATGG + Intronic
1000094699 5:157961078-157961100 GAGAAAAGAAAGTATGGTTCAGG - Intergenic
1001236033 5:170030371-170030393 GAGAGGTGAAAGGATGGAGCAGG - Intronic
1001636249 5:173212524-173212546 GAAAGTAGAAAGGTGGCTGCTGG + Intergenic
1002908382 6:1469315-1469337 GAGTGTAGAAAGGAAGGCGTGGG - Intergenic
1003397804 6:5768064-5768086 GAGAGCTGAAAGAATGGAGCTGG - Intronic
1003487915 6:6595529-6595551 GTGCGTAGAGAGGATGGGGCTGG - Intronic
1005347988 6:24909320-24909342 GAGAATAGCCATGATGGTGCTGG + Intronic
1006209430 6:32382761-32382783 GTCAGTAGAGAGAATGGTGCAGG - Intergenic
1006751527 6:36380903-36380925 GAGAGTAAAAGGGATGCTGTGGG - Intronic
1007009138 6:38397970-38397992 TAGAGTAGAAGGAATGGAGCAGG + Intronic
1007099486 6:39235633-39235655 GAAAGTAGAATGAATGGTGGTGG + Intergenic
1007634986 6:43294204-43294226 GATAGTAGTAATGATGGTGGTGG - Intergenic
1007663129 6:43498661-43498683 GAGAGTGGTAAGGAGGGTGGTGG + Intronic
1007709669 6:43814329-43814351 CAGACTATAAAGAATGGTGCTGG - Intergenic
1007944864 6:45817226-45817248 GAGAGAAGAGAGGAAGGTGGGGG + Intergenic
1008413624 6:51213863-51213885 GAGCGAAGAAAGGAGGGGGCGGG + Intergenic
1009372211 6:62919646-62919668 GAGAATAGAAAGAATGAGGCAGG - Intergenic
1009823493 6:68836343-68836365 GAAAGCAGAAAAAATGGTGCAGG - Intronic
1010330282 6:74615630-74615652 GTGAGTAGGAAGGATGTTCCAGG - Intergenic
1011322258 6:86108670-86108692 GAGAGCAGAAGGAGTGGTGCTGG + Intergenic
1012109075 6:95203317-95203339 GAGAATAGAGAGAATGGTACAGG + Intergenic
1012514960 6:100048709-100048731 GAGAGTGGTAGAGATGGTGCAGG + Intergenic
1012975174 6:105772950-105772972 GAGAGTAGTGAGGATGGGGGCGG + Intergenic
1013269046 6:108528670-108528692 GAGAGTTGCAAGGTTGGGGCTGG - Intergenic
1013425857 6:110012078-110012100 GAGAGCAGGAAAGATGGTGTGGG - Intergenic
1014701063 6:124688635-124688657 GAGGTTAGAAAGGATGGAGGGGG - Intronic
1014776694 6:125519217-125519239 GACAGTAGAAAGGTTGGAGAAGG - Intergenic
1014882329 6:126738630-126738652 GAGAGAAGAAGGGAGGGAGCAGG - Intergenic
1016478683 6:144457469-144457491 TAGAATAGAAATGATGGGGCAGG + Intronic
1016700717 6:147050901-147050923 CAGAGGACAAAGGATGCTGCTGG + Intergenic
1016906576 6:149156812-149156834 GGTAGCAGAAAGGATGGTGCTGG - Intergenic
1016921860 6:149303283-149303305 GACAGTGGAAAGGATGGTTTTGG - Intronic
1017830014 6:158117970-158117992 GAGACTTGAAAAGATAGTGCTGG - Intronic
1017935925 6:159005019-159005041 GAGGGTGGAATGGATGGTGTGGG + Intergenic
1018240966 6:161774356-161774378 GGGAGTAGAAAGGATGGGGGAGG - Intronic
1018398061 6:163395997-163396019 GAGAACAGAAAGGAAGGGGCAGG + Intergenic
1019730632 7:2627555-2627577 GAGAGAGGAAAGGAAGGTGGGGG + Intergenic
1019769999 7:2877530-2877552 GAGACGAAAAAGGAAGGTGCTGG - Intergenic
1021384156 7:20007760-20007782 GACTGTAGGAAGCATGGTGCTGG + Intergenic
1021729781 7:23585121-23585143 GGGAGAAGAAAGGATGCTGAAGG + Intergenic
1021838800 7:24705963-24705985 GAGAGTAGGGAGGCTTGTGCTGG + Intronic
1022184002 7:27949304-27949326 GACAATAGAAAGGCTGGTGGAGG - Intronic
1022943256 7:35258693-35258715 AGGAGGAGAAAGGAGGGTGCAGG - Intergenic
1024613632 7:51088591-51088613 GAGAGCAGAAAGGATGCTGGAGG - Intronic
1026768768 7:73179121-73179143 GAGACTAGAAAAGAGGGTACGGG - Intergenic
1027078405 7:75213533-75213555 GAGACTAGAAAAGAGGGTACGGG + Intergenic
1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG + Intronic
1029733108 7:102450653-102450675 GAAACTAGAAAGGCTGGAGCTGG - Exonic
1030191196 7:106812083-106812105 GGGAGGAGGAAGGATGGGGCTGG - Intergenic
1030482951 7:110127274-110127296 GAGAATAGAAAGGAGGGGGTTGG - Intergenic
1030491510 7:110241033-110241055 GAGAGTAGAAAGGTGGTTACAGG + Intergenic
1031004013 7:116451869-116451891 GAGAGAAAAATGGATGCTGCAGG - Intronic
1032147522 7:129397271-129397293 GAGAGTGGAATAGATGTTGCAGG - Exonic
1032284969 7:130532923-130532945 GAGAGAATGCAGGATGGTGCAGG + Intronic
1032441354 7:131945254-131945276 GAGAGGACAAAGGATGGGGAAGG + Intergenic
1033202783 7:139388015-139388037 GAGAGGAGAAAGAATATTGCAGG - Intronic
1033619720 7:143051324-143051346 GAGAGCAGAAAGGGTGCAGCAGG - Intergenic
1035570568 8:669974-669996 GAGAGGAGAGAGGACGGAGCGGG - Intronic
1035656182 8:1307831-1307853 GAAAGTAGAAAGGAGGCTGCCGG + Intergenic
1036509871 8:9390306-9390328 GAGAGTTGAAAGGGAGGGGCTGG + Intergenic
1036578989 8:10055015-10055037 GAGACAAGAAAGGAGGGCGCAGG - Intronic
1036706503 8:11050863-11050885 GAGAGAAGAGTGGGTGGTGCAGG - Intronic
1036709390 8:11068531-11068553 GGGAGGAGAAAGCATTGTGCAGG - Intronic
1039246999 8:35620103-35620125 CAGAGGTGAAGGGATGGTGCAGG - Intronic
1039432316 8:37534585-37534607 GAGAGTAACAAGAATGGTGGAGG + Intergenic
1040094511 8:43430983-43431005 GAGAGGAGACATGATGGTGGTGG - Intergenic
1040522124 8:48187002-48187024 GAGAGTGGAAAGGGTAGGGCTGG - Intergenic
1041848167 8:62355802-62355824 GAATGTAGAAATGATGGTCCTGG - Intronic
1042778871 8:72467831-72467853 GAGAGGAGAAGGGAGGGTGGGGG + Intergenic
1043225892 8:77729586-77729608 GGGAGTAGAAAGGGTGGGGAGGG - Intergenic
1044293918 8:90505037-90505059 GAGACTGGAATGGAAGGTGCTGG - Intergenic
1044828003 8:96216863-96216885 GAGAGTAGAGGGGTTGGTGAAGG - Intergenic
1046205657 8:110992751-110992773 GGGAGTAGAATGGTTGTTGCTGG + Intergenic
1046679488 8:117152692-117152714 GAGACTAGAAAGTGTGGGGCAGG - Intronic
1046781378 8:118219077-118219099 AACAGTAGAAAGGATGTTGGGGG - Intronic
1047083919 8:121495399-121495421 AAGAATAGAAGGGAAGGTGCTGG - Intergenic
1047593968 8:126357567-126357589 GAGGGTAGAAAGGTTGGTAGGGG + Intergenic
1047596299 8:126381032-126381054 CAGAGTGGAAAGGATGTTTCTGG - Intergenic
1049031059 8:140038167-140038189 GAGAATAAAAAGGATGGCACAGG + Intronic
1049051338 8:140199083-140199105 GAGAGAAGAATGGGTGGAGCTGG + Intronic
1049999490 9:1061334-1061356 GAAAGTAGAAAGGCGGTTGCTGG - Intergenic
1052074034 9:24118553-24118575 AAGATTAGAAACTATGGTGCAGG - Intergenic
1054710626 9:68507513-68507535 AAGAGTAGAAAGTATTGAGCAGG + Intronic
1054848416 9:69821078-69821100 GAGAGGGGAAAGGATGGAACAGG + Intronic
1055360497 9:75485014-75485036 GAGAGTAAAAAGGCTGCTGAAGG + Intergenic
1055626180 9:78179302-78179324 GCGAGTAGAAGGGAAAGTGCAGG + Intergenic
1056498467 9:87184582-87184604 GAGAATAGAAAGCATGAGGCAGG - Intergenic
1056807278 9:89738667-89738689 GAGAGCAGCAAGGATGGGACTGG + Intergenic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1057548656 9:96036217-96036239 GAAAGTAGAAGGGTTGTTGCTGG - Intergenic
1058687292 9:107489839-107489861 GAGAGAAGAAAGGGAGGGGCGGG - Intronic
1059090951 9:111357438-111357460 GAGAGGAGAGAGGATGGCACAGG + Intergenic
1059246445 9:112853684-112853706 GAGAGTAGAACGGTGGTTGCCGG + Intronic
1059419770 9:114183571-114183593 TAGGGTGGAAAGGATGGTGGTGG + Intronic
1060145031 9:121244900-121244922 AAGAATAGAAAGGAAGGTACAGG + Intronic
1060335606 9:122718969-122718991 GAGAGTAGAAAGGGAGAAGCTGG + Intergenic
1061176537 9:129001104-129001126 TAGATTAGAGAGGATGGAGCAGG + Intronic
1061434025 9:130549324-130549346 CAGAGCATGAAGGATGGTGCAGG - Intergenic
1061841978 9:133364076-133364098 GAGAGGAGAGAGGATGTTTCTGG - Intronic
1185777397 X:2815302-2815324 GAGAGAAAAAAGGATGGTTTGGG + Intronic
1185924159 X:4128072-4128094 GAAAATATAAAGGATGGTGTTGG - Intergenic
1186151549 X:6679889-6679911 TAGAGTGGACAGGATGGTGATGG + Intergenic
1188062226 X:25615771-25615793 GAGAGGAGATAGGTTGGTGAAGG - Intergenic
1188505166 X:30874610-30874632 GTGAGTAGCAAGGATGTTGCTGG + Intronic
1190024881 X:46913259-46913281 GAGGGGAGAACGGGTGGTGCTGG + Intronic
1190186601 X:48240056-48240078 GAGAATAGAAAGAATGGGCCTGG - Intronic
1191864741 X:65694869-65694891 CAGGGTAGAAAGGATGGTTATGG + Intronic
1192655301 X:72987161-72987183 GACAGCAGTAAGGAAGGTGCGGG - Intergenic
1192857546 X:75029048-75029070 TAGAGTAGAATGGAGGGTGTGGG - Intergenic
1193089458 X:77478403-77478425 GAGAGTAGAAAGGAAGAATCAGG - Intergenic
1193653835 X:84172929-84172951 GAAAGTAGAAAGGTGGTTGCTGG + Intronic
1194634743 X:96331394-96331416 GAGAGTAGAATGGTGGTTGCTGG - Intergenic
1195457598 X:105086451-105086473 GAGAGTAGAATGGCTGGGGGTGG + Intronic
1197646142 X:129019073-129019095 CAGAGGAGAGAGGATGGTGAGGG - Intergenic
1198559976 X:137838990-137839012 CAGACTAGAAAGGATAGTGGGGG + Intergenic
1199819728 X:151432779-151432801 GAGAGAAGGATGAATGGTGCTGG + Intergenic
1199901062 X:152172764-152172786 GAAAGTAGAATGGTGGGTGCTGG + Intronic
1200099690 X:153684480-153684502 GAGAACAGAAAGAATGGGGCTGG - Intronic
1200243309 X:154508819-154508841 GAGAAAAGAAAGGATGCTGAGGG + Intronic