ID: 1028283638

View in Genome Browser
Species Human (GRCh38)
Location 7:88966908-88966930
Sequence TGCAGCTTGTTGCACTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028283632_1028283638 13 Left 1028283632 7:88966872-88966894 CCTCCCTTTGCTCCACCATAGGT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1028283638 7:88966908-88966930 TGCAGCTTGTTGCACTTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 99
1028283633_1028283638 10 Left 1028283633 7:88966875-88966897 CCCTTTGCTCCACCATAGGTGTA 0: 1
1: 0
2: 1
3: 3
4: 106
Right 1028283638 7:88966908-88966930 TGCAGCTTGTTGCACTTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 99
1028283636_1028283638 -2 Left 1028283636 7:88966887-88966909 CCATAGGTGTACTGATTCCATTG 0: 1
1: 0
2: 2
3: 4
4: 80
Right 1028283638 7:88966908-88966930 TGCAGCTTGTTGCACTTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 99
1028283634_1028283638 9 Left 1028283634 7:88966876-88966898 CCTTTGCTCCACCATAGGTGTAC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1028283638 7:88966908-88966930 TGCAGCTTGTTGCACTTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 99
1028283635_1028283638 1 Left 1028283635 7:88966884-88966906 CCACCATAGGTGTACTGATTCCA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1028283638 7:88966908-88966930 TGCAGCTTGTTGCACTTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028283638 Original CRISPR TGCAGCTTGTTGCACTTCAC AGG Intronic
900926489 1:5709429-5709451 TGCTGCTTCTTGCCCTTCCCAGG + Intergenic
902878567 1:19355797-19355819 AGCATCTTGTGGCACTGCACTGG + Intronic
910272271 1:85409599-85409621 TCCTGCTTGTTGCTCTACACCGG + Intronic
910342181 1:86200790-86200812 TGCAGCTTGTTGGCTTACACTGG - Intergenic
914677111 1:149913843-149913865 TGGGGCTTGGGGCACTTCACTGG + Exonic
915596363 1:156898526-156898548 AGCAGCCTGCTGCACTCCACAGG - Intronic
918329177 1:183440660-183440682 TGAAGCCTGATTCACTTCACAGG + Intergenic
922181005 1:223232821-223232843 GGCAGCTTGTTTGACTTCTCAGG + Intronic
924955849 1:248925898-248925920 TGGAACTTGTTACACTTCTCTGG + Intergenic
1063658351 10:8013980-8014002 TGCAGTTAATTGCACTTCACAGG - Intronic
1066518057 10:36185706-36185728 TGCAACTTGTTGACCTTCTCAGG - Intergenic
1076867940 10:133178231-133178253 TGTAGCGTGTTGCATGTCACAGG + Intronic
1081471718 11:43379352-43379374 TGATGCTTGTTGCATTTCACAGG + Intronic
1095920693 12:47526835-47526857 CCCAGCTTTTTGCACTTCCCGGG + Intergenic
1103038610 12:117676299-117676321 TGCAGCTTGTGCTATTTCACAGG - Intronic
1104230463 12:126879222-126879244 TGCAGCTTTTTGCATTTAGCCGG - Intergenic
1105307385 13:19178654-19178676 TGGAGCTTATTTCCCTTCACTGG - Intronic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1109994706 13:70108090-70108112 TGCAGCTGGATACACCTCACTGG + Exonic
1110708691 13:78626009-78626031 TGCAGTTAGTTCCATTTCACAGG - Intronic
1117811392 14:59551000-59551022 AGCAGGTTGCTGCACTTCACAGG + Intronic
1119392722 14:74302126-74302148 TGCATATTGTTGCATTTCTCTGG - Intronic
1122356027 14:101123407-101123429 TGCAGCTGGATGCATCTCACAGG - Intergenic
1124442138 15:29693814-29693836 TGAAGTTTGTTGTGCTTCACTGG - Intergenic
1134428355 16:14175796-14175818 TGCACATTGTTGCACCTCATCGG - Intronic
1136994399 16:35178970-35178992 TGCAGCTTGTCTCACTTAGCAGG + Intergenic
1138305823 16:55973396-55973418 TGCAGCTTGTGTCACTGCTCTGG - Intergenic
1138535901 16:57660237-57660259 TCCAGCTTGCTGCTCTTCGCGGG + Intronic
1138745374 16:59356995-59357017 TTCAGCTGGTTGCATGTCACAGG + Intergenic
1141150190 16:81559106-81559128 TCCAGCTTGTTGGCCTCCACAGG + Intronic
1145834269 17:27942091-27942113 TGCAGCTTCTTGGACTCCACTGG + Intergenic
1153136751 18:1926340-1926362 TGCAGCTTTATGCGGTTCACAGG + Intergenic
1153384803 18:4480040-4480062 ACCAGCATGTTGCTCTTCACTGG + Intergenic
1156822536 18:41390199-41390221 TGCATCTTATTGCACGTCTCTGG - Intergenic
1159705007 18:71675270-71675292 TGCAGCTTGTTTCCCTGCATTGG + Intergenic
1161408127 19:4101739-4101761 TGCTGCTTGCTTCACTTCTCGGG - Intronic
1163404389 19:17113279-17113301 AGCAGCCTGGTGCACTTCAAAGG + Intronic
926154436 2:10445047-10445069 TGCATTTTGTTGCATTTCAGAGG - Exonic
934693021 2:96376459-96376481 TACAGCTAGGTGCACTTCCCTGG + Intergenic
937562647 2:123244653-123244675 TACAGCTCCTTGCACTTCACAGG - Intergenic
939956827 2:148534328-148534350 TGCAGATGGCTTCACTTCACTGG - Intergenic
947971886 2:234331709-234331731 TGCAGTTTGTAGGGCTTCACTGG + Intergenic
948280576 2:236744648-236744670 TGCAGCTTGTTGCATTTTTGAGG + Intergenic
1172427090 20:34862914-34862936 TGCTGCCCGCTGCACTTCACTGG - Exonic
1175913307 20:62414670-62414692 TGCAGCTTGCTGCACCTCTCTGG - Intronic
1178375399 21:32063044-32063066 TTCTGCTTGAAGCACTTCACTGG + Intergenic
1178932176 21:36829018-36829040 TGCAGCTTGTTTTATTTAACTGG + Intronic
1180901690 22:19377589-19377611 TGCAGCACGTAGCATTTCACTGG + Intronic
1181368948 22:22401215-22401237 TGCATCTTGTTGGACTTCTGAGG + Intergenic
949838277 3:8292654-8292676 TGCCACTTGGTGCACTTCATTGG + Intergenic
951179825 3:19646200-19646222 TGCAGCTTCTTTCATTTCACAGG - Intergenic
957427542 3:80059139-80059161 TTCACTTTGTTGCACGTCACAGG + Intergenic
958191779 3:90193561-90193583 TGCAACCTCTTGCACTTCCCAGG + Intergenic
958892472 3:99795795-99795817 AGCAGTTTGTTAAACTTCACTGG - Exonic
959232457 3:103672482-103672504 TTCAGCTCCTTGCACTTCAAAGG - Intergenic
960703636 3:120460925-120460947 TGCATCTTGTGCGACTTCACTGG - Intergenic
965067672 3:163873278-163873300 TGCAGCTTGTTTGACTTACCTGG + Intergenic
966805986 3:183808043-183808065 TGCAGCCCGTGGCACTCCACAGG + Exonic
968374581 4:28258-28280 TGGAACTTGTTACACTTCTCTGG - Intergenic
972169593 4:36328997-36329019 CTCAGCTTGTAGGACTTCACAGG + Intronic
976750169 4:88445247-88445269 GGCAACTTGTTGCACTCCTCTGG + Intergenic
978607800 4:110501364-110501386 TACAGATTGTTTCACTTCTCAGG + Intronic
982918063 4:161239640-161239662 TGCAGCTTTTTGTCTTTCACAGG + Intergenic
984129936 4:175862212-175862234 TGCAGCTTGTGAAAATTCACTGG - Intronic
985848633 5:2372337-2372359 TCCAGCTTGTGGGACTCCACAGG - Intergenic
986942393 5:12969935-12969957 TGCACCTTATTGATCTTCACTGG + Intergenic
994468094 5:100164275-100164297 AGAAGCTTCTTACACTTCACTGG - Intergenic
1001708440 5:173759090-173759112 TGCAGCTTCTTCAACTTCCCTGG + Intergenic
1002755558 6:156312-156334 TGGAACTTGTTACACTTCTCTGG - Intergenic
1005857555 6:29873977-29873999 TGCATCTTGTTGCCTTTCCCAGG + Intergenic
1006059092 6:31405833-31405855 TGGGGCTTATTTCACTTCACAGG + Intronic
1007758846 6:44119895-44119917 GGCAGGGTGTTGCACTTCTCGGG - Intronic
1009919393 6:70038779-70038801 TACTGGTTGTTGCACTACACTGG + Intronic
1017232813 6:152091217-152091239 TGCTGCCTGTTGCCCTTCAGGGG - Intronic
1017276975 6:152581181-152581203 TTTAGCCTGCTGCACTTCACCGG - Intronic
1017444117 6:154492052-154492074 TGCAGGTTGGTGAACTTGACAGG - Intronic
1019538524 7:1541056-1541078 TGCAGCTTGCTGGTGTTCACTGG + Exonic
1020578004 7:9958592-9958614 TGCAACTTGTGCCACTTCACGGG + Intergenic
1023476158 7:40579983-40580005 TGCAGATTGTTTCATATCACTGG - Intronic
1028283638 7:88966908-88966930 TGCAGCTTGTTGCACTTCACAGG + Intronic
1028725640 7:94084565-94084587 TGCAGCTTGTGGCTCAGCACTGG - Intergenic
1030710574 7:112744039-112744061 TGCAGCCTGGGGCACTTCTCTGG + Intergenic
1037175975 8:15946180-15946202 TGCATGTTATTGCACTTCAGAGG + Intergenic
1038239139 8:25791910-25791932 TGCAGCTTTTGGCACTTAGCAGG + Intergenic
1038916616 8:32031410-32031432 TGCAGCTCGCTGCACGTGACTGG + Intronic
1041991162 8:63993391-63993413 TTCATCTTGTTGCATTTCTCAGG - Intergenic
1043552198 8:81386896-81386918 TGCAGCTTGGTGCCCTTCTGAGG - Intergenic
1044592004 8:93922434-93922456 AGCAGGTTGCTGCACTTCTCCGG - Exonic
1045322876 8:101095278-101095300 GGCTGCTTGTTGCTCTTCCCTGG - Intergenic
1048414999 8:134217848-134217870 GACAGCTTTGTGCACTTCACAGG + Intergenic
1049990986 9:991160-991182 TTTAACTTCTTGCACTTCACTGG + Exonic
1051586690 9:18734090-18734112 GGCAGGTTGTTGAACTTCTCAGG + Intronic
1051755330 9:20393422-20393444 TGCTGATTGTTGCATTTCAAAGG + Intronic
1052089964 9:24315836-24315858 TGAATCCTGATGCACTTCACAGG + Intergenic
1060642174 9:125248306-125248328 TGCAGCTTATTTTACTTCAAAGG - Intergenic
1061102822 9:128504995-128505017 TGCAGGTTGTTAGACTGCACGGG - Intronic
1203574638 Un_KI270744v1:165892-165914 TGGAACTTGTTACACTTCTCTGG + Intergenic
1186342865 X:8661939-8661961 TGCAGCTTGCTCCATTTCATTGG - Intronic
1187358985 X:18606748-18606770 TGCAACTTGTTCCACTTTGCTGG + Intronic
1189162202 X:38820981-38821003 TGCAGCCTGTGGCACTGCAGTGG + Intergenic
1192387850 X:70691498-70691520 TTCACTTTGTTGCACATCACAGG - Intronic
1193079208 X:77389490-77389512 TGCATGTTGTTGCACATGACAGG - Intergenic
1196065014 X:111454593-111454615 TGCAGCTTGTTCCTCCTGACAGG - Intergenic
1196106336 X:111900081-111900103 TACAGCTTGCTGGTCTTCACAGG - Intronic
1196758945 X:119182323-119182345 TGCAGCTTCTTGGACCTCTCTGG - Intergenic
1197256702 X:124271160-124271182 TGCAGTTTTTTGCACTTTAATGG - Intronic
1198405273 X:136305935-136305957 TGCGGCTTGTAGCACGTCATGGG - Intronic
1200154355 X:153967466-153967488 GGCAGCTCGTTGAACTTGACCGG - Intronic