ID: 1028286688

View in Genome Browser
Species Human (GRCh38)
Location 7:89011611-89011633
Sequence ATGCAACTCCACAACCCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1068
Summary {0: 1, 1: 0, 2: 11, 3: 193, 4: 863}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028286684_1028286688 19 Left 1028286684 7:89011569-89011591 CCAAATGGGAGCAATTGGCTAAA 0: 2
1: 53
2: 1578
3: 1927
4: 1587
Right 1028286688 7:89011611-89011633 ATGCAACTCCACAACCCAATAGG 0: 1
1: 0
2: 11
3: 193
4: 863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028286688 Original CRISPR ATGCAACTCCACAACCCAAT AGG Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902084581 1:13849083-13849105 ATGCAAGTCCAAAATTCAATAGG - Intergenic
902085408 1:13856381-13856403 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
903645254 1:24891770-24891792 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
903758658 1:25682680-25682702 GTGAAACTCCACAATCAAATGGG + Intronic
904427399 1:30437838-30437860 ATGCAAATCCAAAACCTAGTGGG - Intergenic
905808395 1:40893741-40893763 ATGCAAGTCCAAAACCCAACAGG + Intergenic
906371648 1:45258850-45258872 ATGCAAGTCCAAAACCCAGCAGG - Intronic
906655197 1:47543144-47543166 ATGCAAGTCCAAAATCCAATGGG - Intergenic
906872917 1:49503697-49503719 ATGCAAGTCCAAAATACAATAGG - Intronic
906937386 1:50226091-50226113 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
907315497 1:53568244-53568266 AGGCAAGTCCAAAACCCAATAGG - Intronic
907687245 1:56623887-56623909 ATGCAAGTCCAAAGCCCACTAGG - Intronic
907808050 1:57841123-57841145 ATGCAAGTCCAAAACCCAACAGG + Intronic
907916133 1:58871717-58871739 ATGCATCTTCACAAACCATTTGG - Intergenic
907925739 1:58953720-58953742 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
908091100 1:60686273-60686295 ATGCAAGTCCAAAATCCAACAGG - Intergenic
908616757 1:65930619-65930641 ATGCAAGTCCAAAACCCAGCAGG - Intronic
908624712 1:66027735-66027757 ATGCAAGTCCAAAATCCAACGGG + Intronic
908746750 1:67383655-67383677 ATGCAAGTCCAAAATCCAGTAGG + Intronic
909058021 1:70845552-70845574 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
909266043 1:73559052-73559074 ATGCAATTGCAAAATCCAATAGG - Intergenic
909293267 1:73911931-73911953 ATGCAAGTCTGAAACCCAATGGG + Intergenic
909416943 1:75416796-75416818 ATGCAAGTCCAAAATCCAACAGG - Intronic
909718659 1:78740263-78740285 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
910270198 1:85386407-85386429 ATGCAAGTCCAAAACTCAGTAGG + Intronic
910546017 1:88420211-88420233 ATGCAAATCCAAAACCCAGCAGG - Intergenic
911023208 1:93409025-93409047 ATGCAAGTTCAAAACCCAACAGG - Intergenic
911277409 1:95879136-95879158 ATCCAAGTCCAAAACCCAGTAGG + Intergenic
911376454 1:97057199-97057221 AAGCAAGTCCAAAATCCAATGGG - Intergenic
911817261 1:102368790-102368812 ATGCAAGTCCAAAACCCAGCTGG - Intergenic
912051990 1:105541473-105541495 AGGCAAGTCCAAAATCCAATAGG + Intergenic
912096473 1:106150425-106150447 ATGCAAATCCAAAATTCAATAGG - Intergenic
912327744 1:108784855-108784877 ATGCAGGTCCAAAATCCAATAGG + Intronic
912579069 1:110704146-110704168 ATGCAACTCTGCAATCCATTGGG + Intergenic
913208374 1:116563140-116563162 ATGCAAGTCCTAAATCCAATAGG + Intronic
913289379 1:117258361-117258383 ATGCAAGTCCTAAATCCAATAGG + Intergenic
913402290 1:118449355-118449377 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
914857481 1:151363150-151363172 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
915804282 1:158828434-158828456 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
915811807 1:158920872-158920894 ATGCAAGTCCAAAATCTAATAGG - Intergenic
915856064 1:159387495-159387517 ATGCAAGTCCAGAATCCAATAGG - Intergenic
916318832 1:163480117-163480139 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
916948755 1:169758078-169758100 ATGCAAGTCCAAAACCCAATAGG + Intronic
917140060 1:171826797-171826819 ATGCATTTCCAAAATCCAATAGG + Intergenic
917355796 1:174125081-174125103 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
918230704 1:182528594-182528616 ATGCAAGTCCAGAATCCAGTAGG + Intronic
918619325 1:186584168-186584190 ATGCAAGTCCAAAATCCAATAGG - Intergenic
918700042 1:187597123-187597145 ATGCAAGTCCAGAATCCAATAGG + Intergenic
918920196 1:190698823-190698845 ATGCAAGTCCAAAATCCAATAGG - Intergenic
918993510 1:191728655-191728677 ATGCAATTCCAAAACCCAGCGGG + Intergenic
919124447 1:193378481-193378503 ATGCAAGTCCAAAATCCAATAGG - Intergenic
919130341 1:193442652-193442674 AAACAAGTCCAAAACCCAATAGG - Intergenic
919194427 1:194264653-194264675 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
921013758 1:211168621-211168643 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
921282269 1:213578641-213578663 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
921531337 1:216285843-216285865 ATGCAAGTCTGAAACCCAATGGG - Intronic
922069138 1:222174088-222174110 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
922530589 1:226342064-226342086 ATGCAAGTCCAAAATCCACTGGG - Intergenic
922667712 1:227487174-227487196 ATGCAATTCCAAAATCCAGTGGG + Intergenic
923172288 1:231429048-231429070 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
923179104 1:231498963-231498985 ATGCAAGTCTAAAATCCAATAGG + Intergenic
923197910 1:231685947-231685969 ATGCAAGTCCAAAATCCAGTGGG + Intronic
923428097 1:233891964-233891986 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
923890864 1:238214017-238214039 ATGCAAGTCCAGAATCCACTGGG + Intergenic
924504360 1:244667362-244667384 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1062770372 10:95261-95283 ATACAAGTCCAAAACCCAACAGG + Intergenic
1065347666 10:24764546-24764568 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1066041066 10:31548438-31548460 ATGCAATTCCAAAACCCAGCAGG - Intergenic
1066098735 10:32098132-32098154 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1067175178 10:43940823-43940845 AAACAAATCCACAACCCAAAAGG - Intergenic
1067351613 10:45481114-45481136 ATGTAAGTCCACAATCCAATGGG - Intronic
1067956349 10:50795537-50795559 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1068128499 10:52869138-52869160 ATGCAAGTCCTAAATCCAATAGG - Intergenic
1068221617 10:54052455-54052477 ATGCAAGTCCAAAATCCAAGAGG - Intronic
1068221980 10:54056935-54056957 ACGCAAGTCCAAAATCCAATGGG + Intronic
1068244215 10:54342858-54342880 ATGCAAGTCCACAACACAGCAGG - Intronic
1068314586 10:55323586-55323608 ATACAACTCCATAATCCAGTGGG - Intronic
1068399461 10:56509333-56509355 ATGCAAGTCCAAAATCCAATGGG - Intergenic
1068449267 10:57165199-57165221 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1069159854 10:65079963-65079985 ATGCAAGTCCAAAATCTAATAGG - Intergenic
1069339944 10:67398341-67398363 ATGCAAGTCCAAGATCCAATAGG - Intronic
1070083107 10:73207746-73207768 ATGCAAGTTCAAAACCCAGTAGG - Intronic
1071018879 10:81029194-81029216 ATGCAAGTCCAAAATCCAATGGG + Intergenic
1071243762 10:83740525-83740547 ATGCAAGTCTAAAATCCAATAGG + Intergenic
1071327862 10:84534628-84534650 ATGCAAGTCCAAAACCCAGTAGG - Intergenic
1071349514 10:84725790-84725812 ATCCCACTACACAACCCATTAGG - Intergenic
1071942089 10:90601380-90601402 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1071980950 10:91003969-91003991 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1072035707 10:91561282-91561304 ATGCAAGTCCAAAATCCAATGGG + Intergenic
1072350006 10:94547682-94547704 ATTGAACTACACAACCAAATAGG + Intronic
1072358317 10:94633781-94633803 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1072808278 10:98439490-98439512 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1072866425 10:99067045-99067067 ATGCAAATCCAAAATCCAATGGG + Intronic
1073628062 10:105119700-105119722 ATGCAAGTCCGAAATCCAATAGG - Intronic
1073708620 10:106015026-106015048 ATGCAAGTCCATAATCCAATAGG + Intergenic
1073794964 10:106977252-106977274 ATGCAAATCCAAACCACAATGGG - Intronic
1074194355 10:111168108-111168130 ATGCAAATCAAAAACACAATGGG - Intergenic
1074242209 10:111650550-111650572 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1074671416 10:115796281-115796303 ATGTACCTCCTCACCCCAATGGG + Intronic
1074965912 10:118490565-118490587 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1077767413 11:5175259-5175281 ATGCAACTGCAAGAACCAATAGG - Intronic
1077953358 11:6986776-6986798 ATGCAAATCAAAACCCCAATGGG + Intergenic
1078117289 11:8466417-8466439 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1078516118 11:12023828-12023850 ATGCAAGTCCAATATCCAATAGG - Intergenic
1078728475 11:13954386-13954408 ATTTAAAGCCACAACCCAATTGG + Intergenic
1078826906 11:14938474-14938496 ATGCAAGTCCAAAACCCAGCAGG + Intronic
1079049880 11:17144945-17144967 ATGCAAGTCCAAAATCCAATAGG - Intronic
1079340978 11:19611584-19611606 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1079511565 11:21216639-21216661 ATGCAAGTCCAAAATCCAATAGG - Intronic
1079656034 11:22987769-22987791 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1079673578 11:23198571-23198593 ATGCAAGTCCAGAATCCAGTGGG + Intergenic
1079707316 11:23637278-23637300 ATGAAACTCCAAATCCCAGTAGG + Intergenic
1079713802 11:23718904-23718926 ATGCAAGTCCAAAACCCATCAGG - Intergenic
1079721862 11:23825736-23825758 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1079945268 11:26733470-26733492 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1079949642 11:26785128-26785150 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1079973079 11:27059769-27059791 ATGCAAGTCCAAAACCCAGCAGG - Intronic
1080045034 11:27799413-27799435 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1080183086 11:29446889-29446911 ATGCAAGTCCAAAATCCAACAGG - Intergenic
1080404839 11:31969975-31969997 ATGCCACTCCACAACAAACTAGG + Intronic
1081080406 11:38733249-38733271 ATGCAAGTCCAAAATCCTATAGG + Intergenic
1081122545 11:39285051-39285073 ATGCAAGTCTGCAATCCAATGGG + Intergenic
1081157858 11:39716635-39716657 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1081236619 11:40654470-40654492 ATGCAAGTCCAAAATCCAACAGG - Intronic
1081316478 11:41637155-41637177 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1081358544 11:42144249-42144271 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1081939509 11:46928753-46928775 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1082626724 11:55495846-55495868 ATTCAACTCCAAAATCCAATAGG + Intergenic
1082947924 11:58780135-58780157 ATGCAAGTTCAAAATCCAATAGG + Intergenic
1084280580 11:68088335-68088357 ATGCCACTCCAAGACCAAATGGG - Intronic
1085651606 11:78273441-78273463 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1085861894 11:80244679-80244701 ATGCAAGACCAAAATCCAATAGG - Intergenic
1085875817 11:80405085-80405107 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
1086231795 11:84578520-84578542 ATGCAAATCCAAAATCCAGTGGG - Intronic
1086503739 11:87479981-87480003 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1086557377 11:88127025-88127047 ATGAAACTTCAGAACCCACTTGG - Intronic
1086605067 11:88686246-88686268 ATGCAACTCCAAAATCCAGCAGG - Intronic
1086936029 11:92746792-92746814 ATGCAAGTCCAAAATCCAATAGG + Intronic
1086975984 11:93133382-93133404 ATGCAAATCCACACACTAATTGG - Intergenic
1087255485 11:95948271-95948293 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1087337141 11:96858575-96858597 ATGCAAATCAAAATCCCAATGGG - Intergenic
1087447008 11:98268414-98268436 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1087877544 11:103375638-103375660 ATGCAAGTCCAAAATGCAATAGG - Intronic
1088397228 11:109382139-109382161 ATGCAAGTCCAAAACCCAGTGGG + Intergenic
1089825800 11:121275802-121275824 ATGCAAATCCAAACCACAATGGG - Intergenic
1090595287 11:128314689-128314711 ATGCAAGTCCAAAACCCAGTAGG + Intergenic
1092618112 12:10234117-10234139 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1092665370 12:10791291-10791313 ATGCAGGTCCAAAATCCAATGGG + Intergenic
1093037980 12:14351351-14351373 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1093076237 12:14761346-14761368 ATGCAAATCCAAAACCCAGCGGG - Intergenic
1093141770 12:15517690-15517712 ATGCAACTCCAAAATCCACTGGG + Intronic
1093299720 12:17439369-17439391 ATGCAACTCCTAAACCCAGCAGG + Intergenic
1093350941 12:18102803-18102825 ATGCAAGTCCAAAACCCAGCAGG + Intronic
1093591188 12:20904350-20904372 ATGCAAGTTCAGAACCCAACAGG + Intronic
1093744771 12:22727865-22727887 ATGCTACTCAGCAACACAATGGG + Intergenic
1094379793 12:29830732-29830754 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1094421088 12:30272328-30272350 ATGCAAGCCCAAAATCCAATAGG + Intergenic
1094706133 12:32915971-32915993 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1094777421 12:33746309-33746331 ATGCAAGTCCAAAACCCAGTAGG - Intergenic
1095097746 12:38157247-38157269 AAGCGACTCCACAACCCTATTGG - Intergenic
1095530533 12:43181901-43181923 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1095639305 12:44468400-44468422 ATGCAAGTCCAAAACGCAGTAGG - Intergenic
1095689209 12:45068689-45068711 ATGCAAGTCCCAAATCCAATAGG + Intergenic
1095765099 12:45886222-45886244 ATCCAAATCCATAATCCAATAGG + Intronic
1095872934 12:47050599-47050621 ATGCAAGTCCAGAACCCAGCAGG + Intergenic
1095919657 12:47516670-47516692 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1096904998 12:54927088-54927110 ATGCAAGTCCAAAATCCAACAGG - Intergenic
1097136943 12:56864876-56864898 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
1097139356 12:56886881-56886903 ATGCAAGTCCAAAACCCAGAAGG - Intergenic
1097513161 12:60568421-60568443 ATGCAAATCCAAAACCTAAAAGG - Intergenic
1097522713 12:60689043-60689065 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1097599157 12:61670460-61670482 ATGCAAATCCAAAATCTAATAGG + Intergenic
1097757841 12:63426801-63426823 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1097955727 12:65483702-65483724 ATGCAAGTCTAAAACCCAGTGGG + Intronic
1098182691 12:67864634-67864656 ATGCAACTCAAAACCACAATGGG - Intergenic
1098203631 12:68083439-68083461 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1098319904 12:69232574-69232596 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1098741498 12:74178786-74178808 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1098836449 12:75429317-75429339 ATGCAAGTTCAAAACCCAACAGG - Intronic
1099096252 12:78378603-78378625 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1099150991 12:79113810-79113832 ACCCAACACCTCAACCCAATAGG + Intronic
1099229227 12:80003272-80003294 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1099396459 12:82146828-82146850 ATGCTAATCCACAAGACAATGGG + Intergenic
1099607997 12:84829279-84829301 ATGCAAGTCCCAAATCCAATAGG - Intergenic
1099724849 12:86412479-86412501 GTGCAAATCCAAAACTCAATAGG - Intronic
1099805809 12:87517671-87517693 AAGCAACTCCAAAACCTAACAGG + Intergenic
1099838563 12:87937708-87937730 ATGCAAGTCCAAAATCCAACAGG - Intergenic
1099899895 12:88695151-88695173 GTGCAAGTCCAAAATCCAATAGG + Intergenic
1099911380 12:88838524-88838546 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1100051942 12:90459939-90459961 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1100336215 12:93632861-93632883 ATGCAAGTCCAAAACCCAGAGGG - Intergenic
1100674804 12:96855556-96855578 ATGCAAGTCCAAAATCCAAAAGG + Intronic
1100898861 12:99215647-99215669 ATGCAAGTCCAAAATCCAATAGG - Intronic
1100993455 12:100276019-100276041 ATCCAACCCCACGACCAAATGGG - Intronic
1101083834 12:101215184-101215206 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1101526324 12:105534620-105534642 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1102669016 12:114601362-114601384 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1103263580 12:119610171-119610193 ATGCAAGTCCAAAATCCAATAGG - Intronic
1104340113 12:127941106-127941128 ATGCAACTTCACAAATTAATTGG + Intergenic
1104588036 12:130063120-130063142 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1104741990 12:131184437-131184459 ATGCAAGTCCAGAATCCAACTGG + Intergenic
1105257947 13:18757179-18757201 ATGCAAATCCAAAACCCAGCAGG + Intergenic
1105258797 13:18763491-18763513 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1105260601 13:18776490-18776512 ATGCAAATCCAAAACCCAGCAGG + Intergenic
1105261466 13:18782794-18782816 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1105262892 13:18792889-18792911 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1105263812 13:18799372-18799394 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1106734868 13:32578468-32578490 ATGCAAGTCCAAAATTCAATAGG - Intergenic
1106864508 13:33948766-33948788 ATGCAAGTCCAAAATCCAATAGG - Intronic
1107039377 13:35933084-35933106 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1107188440 13:37550314-37550336 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1107962012 13:45567074-45567096 ATGAAAGTCCAAAATCCAATAGG - Intronic
1108219349 13:48217211-48217233 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1108419553 13:50234350-50234372 ATGCAAGTCCTAAATCCAATGGG - Intronic
1108603778 13:52017109-52017131 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1108719575 13:53117436-53117458 ATACAAATCCAAAATCCAATGGG + Intergenic
1108874282 13:55025641-55025663 ATGCAACTCTAAAACCCAATAGG - Intergenic
1108930047 13:55806936-55806958 ATGCAAGTCTAAAACTCAATAGG + Intergenic
1108979434 13:56491997-56492019 ATGCAACTCCAAAACCCAGCAGG + Intergenic
1109006409 13:56883002-56883024 ATGCAAATCCAAAATCCAGTGGG - Intergenic
1109086034 13:57972752-57972774 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1109168760 13:59069836-59069858 ATGACACTCCACAACCAAATTGG + Intergenic
1109189464 13:59307690-59307712 ATGCAAGTCCAAAATGCAATAGG + Intergenic
1109750586 13:66685812-66685834 ATGCAAGTCCAAAATGCAATAGG - Intronic
1109862938 13:68224533-68224555 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1110440630 13:75521643-75521665 ATGCAAGTCCAAAACCCATCAGG - Intergenic
1110566157 13:76959497-76959519 ATGCAAATCCAAAACCCAGCGGG + Intergenic
1110902111 13:80836847-80836869 ATGCAAATCCAAAACCCAGTAGG + Intergenic
1111268376 13:85849819-85849841 ATGCAAATCCAAAATCCAGTGGG + Intergenic
1111307588 13:86435018-86435040 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1111318126 13:86587037-86587059 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1111372075 13:87332694-87332716 ATGCAAGTCCAAAATACAATGGG + Intergenic
1111443009 13:88304891-88304913 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1111583964 13:90261005-90261027 ATGCAAGTCCAAAACCCAGTAGG + Intergenic
1111594189 13:90389893-90389915 ATGCAAATCCAAAACCCAGTGGG - Intergenic
1111737797 13:92164413-92164435 ATGCAAATCCAAAATCCAATAGG + Intronic
1112252160 13:97792438-97792460 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1112623701 13:101078518-101078540 ATGCAAGTCCAAAATCCAATAGG - Intronic
1112789460 13:102987443-102987465 ATGCAAATCCAAAATCCAATAGG + Intergenic
1112855759 13:103768030-103768052 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1112970410 13:105254697-105254719 ATGAAAGTCCAAAACCCAACAGG - Intergenic
1112996008 13:105575710-105575732 ATGCCAGTCCAAAATCCAATAGG - Intergenic
1113029316 13:105976280-105976302 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1113376606 13:109770071-109770093 TTGGAGCTCCCCAACCCAATGGG + Intronic
1113501795 13:110781733-110781755 ATCCAAGTCCAAAACCCAGTGGG + Intergenic
1113645365 13:111991176-111991198 ATGCAAATCCAAAATCCAGTGGG - Intergenic
1114160676 14:20162923-20162945 ATACAAGTCCAAAATCCAATAGG + Intergenic
1114680410 14:24479517-24479539 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1114922037 14:27343838-27343860 ATGCAACTCCAAAATCCAACAGG - Intergenic
1115021348 14:28684625-28684647 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1115065616 14:29256639-29256661 ATGCAAGTCCAAAACCCAATAGG + Intergenic
1115085716 14:29512844-29512866 ATGCAAATCCAAAATCCAGTGGG + Intergenic
1115277373 14:31623150-31623172 ATGCAAGTCCAAAATCCAGTAGG - Intronic
1115481666 14:33867231-33867253 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1115929830 14:38478478-38478500 ATGAAACTCCAAAATCCAATAGG - Intergenic
1115940828 14:38608271-38608293 AAGTAAGTCCAAAACCCAATAGG + Intergenic
1115970385 14:38939001-38939023 ATGCAACTCAAAACCACAATGGG + Intergenic
1116119626 14:40705894-40705916 ATGCCAGTCCAAAACCCAACAGG + Intergenic
1116362189 14:44014228-44014250 ATGCAAGTCCAAAATCCAATGGG - Intergenic
1116378337 14:44232080-44232102 ATGCAAGTCCAAAATCCAATGGG + Intergenic
1116592448 14:46795624-46795646 ATGCAACTCAAAATCACAATGGG - Intergenic
1116714093 14:48406600-48406622 ATGCAAGTCCGAAATCCAATAGG + Intergenic
1117085562 14:52196835-52196857 CTGCAAGTCCAAAACCCAATAGG - Intergenic
1117758312 14:58999196-58999218 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1117984481 14:61374111-61374133 ATGCAAGTCCAAAACCCAGCAGG + Intronic
1118092434 14:62497351-62497373 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1119040460 14:71269843-71269865 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1120132321 14:80822378-80822400 ATGCAAGTCCAAAATCCAACAGG + Intronic
1120257815 14:82141975-82141997 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1120270733 14:82310034-82310056 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1120481708 14:85057056-85057078 ATGCTACTCCACACACAAATAGG + Intergenic
1120583294 14:86280248-86280270 ATGCAACTCCAAAAGCCCACAGG - Intergenic
1120692257 14:87605815-87605837 ATGCAACTCCAAAATCCAGTGGG + Intergenic
1120707607 14:87760972-87760994 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1120933722 14:89873683-89873705 ATGCAACTCCTAAATCCAGTGGG + Intronic
1121166591 14:91807535-91807557 ATGCAAGTCCACAATCCAGCAGG - Intronic
1121318858 14:92979152-92979174 ATGCAAGTCCAAAACCCAGCAGG - Intronic
1121672650 14:95724527-95724549 ATGCAAGTCCAAAACCCAACAGG - Intergenic
1122034551 14:98937886-98937908 ATGCAGCTCCAGAGCCCAAAAGG + Intergenic
1202835433 14_GL000009v2_random:74670-74692 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1124508991 15:30306410-30306432 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1124556007 15:30726675-30726697 ATGCAAGTCCAAAATCCAGTAGG + Intronic
1124675267 15:31679096-31679118 ATGCAAGTCCAAAATCCAGTAGG - Intronic
1124734566 15:32232252-32232274 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1125230856 15:37453333-37453355 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1125233361 15:37483605-37483627 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1125806518 15:42497914-42497936 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1125857987 15:42969231-42969253 ATGCAACTCAAAAGCACAATGGG - Intronic
1126256157 15:46627766-46627788 ATGCAAGTGCAGAATCCAATAGG - Intergenic
1126533184 15:49732841-49732863 ATACAAGTCCAAAACCCAATAGG + Intergenic
1126562714 15:50061037-50061059 ATTCAACTCCACGACCTACTGGG - Intronic
1127791156 15:62399680-62399702 ATGCAAGTCCAAAATCCAATAGG - Intronic
1127816714 15:62617062-62617084 ATTCAACTCCAAACCCCAACAGG - Intronic
1128718550 15:69928471-69928493 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1129469532 15:75743116-75743138 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1129812698 15:78523797-78523819 ATGCAAGTCCAAAACCCAGCAGG + Intronic
1130137306 15:81192075-81192097 ATAGAACTGCACAACACAATGGG + Intronic
1130210737 15:81919324-81919346 ATGCAAGTCCAAAATGCAATAGG - Intergenic
1130409257 15:83631086-83631108 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1130778482 15:87009800-87009822 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1130791536 15:87160764-87160786 ATGCAAGTCCAAAGTCCAATAGG - Intergenic
1131427104 15:92354600-92354622 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1131659598 15:94499357-94499379 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1132959196 16:2612764-2612786 AAGCAACCCCACACCCCATTCGG - Intergenic
1132972256 16:2694739-2694761 AAGCAACCCCACACCCCATTCGG - Intronic
1135208867 16:20507093-20507115 ATGCAAATCCATAATCCAATAGG + Intergenic
1135275948 16:21112857-21112879 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1137265777 16:46868016-46868038 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1137778575 16:51077387-51077409 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1138198404 16:55071314-55071336 ATGCAAATCCAAAATCCAGTAGG + Intergenic
1140146830 16:72319525-72319547 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1141317902 16:82979085-82979107 ATGCAAGTCTAGAATCCAATAGG - Intronic
1142909819 17:3079555-3079577 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1142924683 17:3224254-3224276 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1144508858 17:15857663-15857685 AGGCAAGTCCAAAACCCAGTGGG - Intergenic
1144665506 17:17099292-17099314 ATGCAACTCAGTAACCCTATAGG - Intronic
1145172973 17:20675303-20675325 AGGCAAGTCCAAAACCCAGTGGG - Intergenic
1146391856 17:32430151-32430173 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1146451858 17:32981154-32981176 ATGCAAGTCCAAAATCCAGTTGG + Intronic
1146452674 17:32987166-32987188 ATGCAAGTCCAAAACCCAGCTGG + Intronic
1146571625 17:33958010-33958032 ATGCAAGTCCAAAATCTAATAGG + Intronic
1146773786 17:35593815-35593837 ATGTAACTCCTCAAGCTAATGGG - Intronic
1147348841 17:39824219-39824241 ATGCAAGTCCGGAATCCAATAGG - Intronic
1149072274 17:52556940-52556962 TTGCAAGTCCAAAATCCAATAGG - Intergenic
1149159035 17:53668132-53668154 ATGCAAGTCCTAAATCCAATAGG - Intergenic
1149163857 17:53726567-53726589 ATGCAAGTCCAAAATCCAATTGG + Intergenic
1149175662 17:53867534-53867556 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1149339606 17:55672059-55672081 ATGCAAGTGCAAAATCCAATAGG + Intergenic
1149341181 17:55687847-55687869 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1149386265 17:56146079-56146101 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1150515800 17:65808170-65808192 ACGCAAGTCCAAAACCCAACAGG - Intronic
1150687462 17:67332101-67332123 ATGCAAGTCCAAAATCCAACGGG - Intergenic
1151435319 17:74092161-74092183 AAGTAAGTCCAAAACCCAATGGG + Intergenic
1151915043 17:77111643-77111665 ATGCAAGTCCAAAATCTAATAGG - Intronic
1154424556 18:14262015-14262037 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1154425413 18:14268306-14268328 ATGCAAGTCCATAACCCAGCAGG - Intergenic
1154425806 18:14271223-14271245 ATGCAAATCCATAACCCAGCAGG - Intergenic
1154426326 18:14274881-14274903 ATACAACTCCAAAACCCAGAAGG - Intergenic
1154427243 18:14281365-14281387 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1154428142 18:14287894-14287916 ATGCAAATCCATAACCCAGCAGG - Intergenic
1154428555 18:14290821-14290843 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1154429964 18:14300900-14300922 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1154432251 18:14317242-14317264 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1154433109 18:14323549-14323571 ATGCAAATCCATAACCCAGCAGG - Intergenic
1154433500 18:14326469-14326491 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1155083402 18:22432138-22432160 ATGCACCACCACACCCCAAATGG + Intergenic
1155085399 18:22453214-22453236 ATGCTACTCCAGACCCCAATAGG + Intergenic
1155275145 18:24180184-24180206 ATAAAACTCCACAACTTAATTGG + Intronic
1155413461 18:25571207-25571229 ATGCAATTCCAAAATCTAATAGG + Intergenic
1155544689 18:26903241-26903263 ATGCAAGTCCGAAATCCAATAGG + Intergenic
1155745890 18:29356099-29356121 ATGCAAGTCCAAAACCCAGCTGG - Intergenic
1156052284 18:32951910-32951932 ATGCAAGTCCAAAATCCAATAGG + Intronic
1156081493 18:33341193-33341215 ATGCAAGTCCAAAATCCAATGGG - Intronic
1156614940 18:38772239-38772261 ATGTAAGTCCAAAACCCAACAGG + Intergenic
1156683253 18:39616605-39616627 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1157408893 18:47447139-47447161 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1157843003 18:50976928-50976950 ACGCAAGTCCAAAATCCAATAGG + Intronic
1158124143 18:54083211-54083233 ATGCAAGTCCAGAATTCAATAGG - Intergenic
1158223086 18:55169804-55169826 AAGCAAGTCCAAAACCCTATAGG - Intergenic
1159261254 18:66015978-66016000 ATGCAAGTCCAAAATGCAATGGG + Intergenic
1159606343 18:70478726-70478748 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1159695700 18:71553697-71553719 ATGCAAGTTCAAAACCCAATGGG - Intergenic
1159718725 18:71858722-71858744 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1159896059 18:73996979-73997001 ATGCAAGTCCGAAATCCAATAGG - Intergenic
1160573807 18:79837168-79837190 ATGCAAATCCAAAACCCAGCAGG + Intergenic
1162002827 19:7758194-7758216 ATGCAAGTCTGAAACCCAATAGG - Intergenic
1164036546 19:21460762-21460784 ATGCAACTCCAAAACCCAGAAGG + Intronic
1164242552 19:23402649-23402671 ATGCAACTCTACTACCCACAAGG - Intergenic
1164447462 19:28330206-28330228 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1168516477 19:57013629-57013651 ATGCAAATCCAAAACCCAGTAGG - Intergenic
925001136 2:403709-403731 ATGCAAGTCCAAAATCCAACAGG + Intergenic
925794880 2:7530741-7530763 ATGCAAGTCCAAAACCCGACTGG + Intergenic
926024418 2:9528716-9528738 ATGCAAATCAAAACCCCAATGGG + Intronic
926392024 2:12403292-12403314 ATGCAAGTCCAAAATCCAATAGG - Intergenic
926465013 2:13177051-13177073 ATGCAAGTCCAAAATCCAATAGG + Intergenic
926611838 2:14955160-14955182 ATGGAAATCCAAAATCCAATAGG + Intergenic
927083984 2:19656363-19656385 AAGTAAGTCCAAAACCCAATAGG + Intergenic
927170801 2:20367766-20367788 ATGAAAGTCCAAAATCCAATAGG + Intergenic
927400678 2:22706917-22706939 ATGAAAGTCCAGAATCCAATAGG + Intergenic
928725712 2:34171549-34171571 ATGCAAGTCCAGAATCCAATAGG + Intergenic
928749973 2:34459513-34459535 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
929226994 2:39521393-39521415 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
929260793 2:39864435-39864457 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
930507815 2:52305822-52305844 ATGCAATTCCAAAATCCAACAGG - Intergenic
930560027 2:52949627-52949649 ATGCAAGTCCGAAATCCAATAGG + Intergenic
930687608 2:54325973-54325995 ATGCACATCCAAAACCCAACAGG - Intergenic
931145126 2:59508601-59508623 ATGCAAGTCCACAATGCAGTGGG - Intergenic
931494038 2:62783075-62783097 ATGCAAGTCCAAAATCCAACAGG + Intronic
932249556 2:70230816-70230838 ATGAAACTCCACAAAACAATAGG + Exonic
932821556 2:74906008-74906030 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
932915772 2:75856298-75856320 ATGCAAGTCCAAAATCCAATAGG - Intergenic
933508045 2:83203852-83203874 ATGCAAGTCCAAAATCCAGTTGG + Intergenic
933521637 2:83381487-83381509 ATGCAATTCCAAAACCCAGCAGG - Intergenic
933584884 2:84169370-84169392 ATGCAAGTCCAAAATCCAAATGG - Intergenic
933805224 2:85994238-85994260 ATGAAACCCCACAGCCCAAAGGG + Intergenic
933985892 2:87591865-87591887 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
934492080 2:94768389-94768411 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
934492676 2:94772384-94772406 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
935425722 2:102916730-102916752 ATGCAAATCCAAAATCCAGTGGG + Intergenic
936307947 2:111358939-111358961 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
936685442 2:114821747-114821769 ATGCAAGTCCAAAATCCAATAGG + Intronic
936753782 2:115678915-115678937 ATGCAAGTCCAAAATCCAAGAGG - Intronic
936794939 2:116193910-116193932 ATGCAAGTCCAAAATCCAACAGG + Intergenic
936850733 2:116895188-116895210 ATGCAAATCCACAACCTAGTAGG + Intergenic
936909356 2:117574658-117574680 ATGCAAGTCCCAAATCCAATAGG + Intergenic
936940932 2:117883349-117883371 ATGAAAGTCCAAAATCCAATAGG - Intergenic
937117700 2:119420462-119420484 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
937427730 2:121813910-121813932 ATGCAATTCCAAAACCCAGCAGG - Intergenic
937497479 2:122437002-122437024 ATGCAAGTCCGAAATCCAATGGG + Intergenic
937828043 2:126389139-126389161 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
938510347 2:131936174-131936196 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
938883747 2:135620778-135620800 ATGTAATTCCAGAACCCAAAGGG - Intronic
939498213 2:142949035-142949057 ATGCAAGTCCAAAATCCAGTGGG + Intronic
939559208 2:143713737-143713759 ATGCAAGTCCAAAATCCAGTGGG + Intronic
940387090 2:153086048-153086070 ATGAAAGTCCAAAATCCAATAGG - Intergenic
940408862 2:153336490-153336512 ATGCAAGTCCAAAATCCAAGGGG - Intergenic
940444875 2:153765402-153765424 ATGCAAGTCCAAAACCCAATAGG - Intergenic
940547096 2:155102002-155102024 ATGCAAGTCCAAAATCCAATGGG + Intergenic
941247177 2:163113161-163113183 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
941346318 2:164373001-164373023 ATGCAAGTCCAAAATCCAATAGG - Intergenic
941525022 2:166596762-166596784 ATGCAAGGCCAAAATCCAATAGG + Intergenic
941682558 2:168414702-168414724 ATGCGAGTCCAAAACCCAATAGG + Intergenic
942118098 2:172748915-172748937 ATGCAAGTCCAAAATCCAGTGGG + Intronic
942283459 2:174390335-174390357 ATGCAAGTCCAAAATCCAATAGG - Intronic
942319534 2:174724479-174724501 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
943193893 2:184718622-184718644 ATGCAAGTCCAAAATCCAGTGGG + Intronic
943231863 2:185264410-185264432 ATGCAAGTCCAAAATCCAATAGG + Intergenic
943313298 2:186353892-186353914 ATGCAAGTCCAAAATCCAACAGG - Intergenic
943415017 2:187591036-187591058 ATGCAAATCCAAAACCCAGCAGG + Intergenic
943417862 2:187630893-187630915 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
943484030 2:188456964-188456986 ATGCAAGTCCAAAATCCAGTGGG - Intronic
944491598 2:200263299-200263321 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
944872691 2:203930590-203930612 ATGCAAGTCCGAAATCCAATAGG - Intergenic
944943008 2:204651371-204651393 ATGCAAGTCCAAAACCCAGCAGG + Intronic
945109494 2:206348955-206348977 ATGCAAGTCCAAAAGCCAGTGGG + Intergenic
945114178 2:206394484-206394506 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
945333204 2:208562689-208562711 ATGCAAGTCCAAAATCCAATAGG + Intronic
945484832 2:210382536-210382558 ATGCAAGTCCAAAATCCAATAGG - Intergenic
946515321 2:220405148-220405170 ATGCGAGTCCAAAATCCAATAGG + Intergenic
946543914 2:220715899-220715921 ATGCAATTCCAAAACCCAACAGG + Intergenic
946581041 2:221128465-221128487 ATGCAAATGCAAAACCCAACAGG - Intergenic
946930009 2:224661967-224661989 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
946937506 2:224737000-224737022 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
946995361 2:225384668-225384690 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
947008373 2:225537947-225537969 ATGCAAGTCCAAAATCCAGTGGG + Intronic
947011433 2:225571004-225571026 ATGCAAGTCCAAAATCCAATAGG + Intronic
947070299 2:226281106-226281128 ATGCAAGTCCAAAATCCAACAGG - Intergenic
947443248 2:230141538-230141560 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
948141246 2:235673382-235673404 ATGCAAGTCCCCAAACCACTGGG + Intronic
1168798396 20:627670-627692 CTCCAACTCCCCAACCCGATAGG + Intergenic
1170065211 20:12303342-12303364 ATGCAAGTTCAGAATCCAATAGG + Intergenic
1171883354 20:30633702-30633724 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1171883750 20:30636625-30636647 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1172792746 20:37517369-37517391 ATCCAACACCACGACCCAAATGG + Intronic
1173323339 20:42009625-42009647 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1175008577 20:55711284-55711306 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1176016558 20:62936897-62936919 TTGCAACTACATAACCCTATGGG - Intronic
1176315378 21:5237604-5237626 ATGCAAGTCCAAAATTCAATGGG - Intergenic
1176783481 21:13227152-13227174 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1176843601 21:13859716-13859738 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1176843936 21:13862208-13862230 ATGCAAGTCCAAAACCCAGCGGG + Intergenic
1176844788 21:13868511-13868533 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1176846624 21:13881529-13881551 ATGCAAGTCCAAAACCCAGCGGG + Intergenic
1176848950 21:13898143-13898165 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1176869240 21:14073046-14073068 CAGCGACTCCACAACCCCATTGG + Intergenic
1177043418 21:16141126-16141148 ATGAGACAACACAACCCAATTGG - Intergenic
1177220295 21:18183643-18183665 CTGCAAATCCACAACAAAATGGG - Intronic
1177236059 21:18391425-18391447 ATGCAACTCCAAAATCCAGCAGG + Intronic
1177261363 21:18733614-18733636 ATGCAATTCCAAAATCCAGTAGG - Intergenic
1177271162 21:18850803-18850825 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1177402377 21:20623000-20623022 ATGCAAGTCCAAAACTCAAAAGG + Intergenic
1177473163 21:21584529-21584551 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
1177479550 21:21669165-21669187 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1177487422 21:21777603-21777625 ATGCAACTCCAAAATCCAGCTGG + Intergenic
1177606096 21:23379384-23379406 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
1177656264 21:24020726-24020748 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1177686794 21:24447571-24447593 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1177854280 21:26383974-26383996 TTGCAAGTCCAAAATCCAATAGG - Intergenic
1177857833 21:26419628-26419650 GTGCAAGTCCAAAATCCAATGGG + Intergenic
1177881615 21:26701955-26701977 ATGCAAGTCCAAAAACAAATAGG + Intergenic
1177918654 21:27123660-27123682 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1178174054 21:30076342-30076364 ATGCAAGTCCAAAATCCAACAGG - Intergenic
1178338689 21:31766701-31766723 ATGCAAGTCCAAAGTCCAATAGG - Intergenic
1178468954 21:32874756-32874778 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1180393162 22:12303559-12303581 ATGCAAGTCCAAAATTCAATGGG - Intergenic
1180406587 22:12561209-12561231 ATGCAAGTCCAAAATTCAATGGG + Intergenic
1182815713 22:33161601-33161623 TTGCAAGTCCAAAATCCAATAGG + Intergenic
1182868817 22:33628037-33628059 ATGCAAATCCCCAACCCAGATGG + Intronic
1183847453 22:40554005-40554027 ATGCAAGTCCAGAATCCAGTGGG - Intronic
1184129952 22:42511872-42511894 ATGCAACTTCACAACTCAGCTGG + Exonic
1184140128 22:42573690-42573712 ATGCAACTTCACAACTCAGCTGG + Intronic
1184927960 22:47657332-47657354 ATGCAACTCCACAGCACACAGGG - Intergenic
949140543 3:627852-627874 AAGTAAGTCCAAAACCCAATAGG + Intergenic
950196926 3:11015833-11015855 ATGCAACTCTACAAGCCAGAGGG + Intronic
950647736 3:14387341-14387363 AAGCGACTCCACACCCCACTGGG - Intergenic
950843176 3:15987733-15987755 ATGCAAGTCCAAAATCCATTGGG + Intergenic
950853091 3:16081480-16081502 ATGCAAGTCCAAAATCCAATAGG + Intergenic
950990596 3:17433911-17433933 ATGCAAGTCCAAAATCCAAGAGG + Intronic
951037732 3:17951994-17952016 ATGCAACTCCGAAATCCAATAGG - Intronic
951100704 3:18684690-18684712 ATGCAAGTCCAAAACCCAGCTGG - Intergenic
951756386 3:26096005-26096027 ATGCAAGTCCAAAATTCAATGGG + Intergenic
952185160 3:30960751-30960773 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
952397164 3:32930995-32931017 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
952401288 3:32966363-32966385 ATGCAAGTCCAAAACCCAATAGG - Intergenic
952569845 3:34701422-34701444 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
952831332 3:37567696-37567718 ATGCAAGTCCAAAACCCAGCGGG + Intronic
955395372 3:58553600-58553622 ATGCAAATCCAAAACCCAGCAGG + Intergenic
955900308 3:63746830-63746852 TTGCAAATCCACGACCCATTTGG + Intergenic
956185608 3:66559496-66559518 ATGCAAGTCCGAAATCCAATGGG + Intergenic
956475026 3:69610487-69610509 ATGCAAATCCAAAATCCAGTGGG - Intergenic
956489268 3:69753719-69753741 ATGCAAGTCCAAAACCCAGCAGG - Intronic
956911463 3:73822042-73822064 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
956947013 3:74234624-74234646 ATGCAAGTCCAAACTCCAATAGG + Intergenic
957012862 3:75028036-75028058 ATGCAAGTCCAAAATCCAATAGG + Intergenic
957412875 3:79862878-79862900 ATGCAAGTCCAAAAACCAATGGG - Intergenic
957447027 3:80326194-80326216 ATGCAAGTCTAAAACCCCATAGG - Intergenic
957474353 3:80704849-80704871 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
957557452 3:81780369-81780391 ATGAAAGTCCAAAATCCAATAGG + Intergenic
957576552 3:82015243-82015265 ATGCAAGTTCACAACCCAACAGG - Intergenic
957625281 3:82647060-82647082 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
957710987 3:83859598-83859620 ATGCAAATCCAAAACCCATCAGG + Intergenic
957870247 3:86082756-86082778 ATGCAAGTCCAAAATCCAGTTGG + Intergenic
957909924 3:86607633-86607655 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
957920991 3:86748344-86748366 ATGCAAGTCCAAAATCAAATAGG - Intergenic
957929827 3:86863462-86863484 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
957978273 3:87474747-87474769 ATGCAAGTCCAAAATCAAATAGG - Intergenic
957982356 3:87526007-87526029 ATGCAAATCCAAAATCCAATAGG - Intergenic
957987411 3:87589803-87589825 ATGAAAGTCCAAAATCCAATAGG + Intergenic
957988099 3:87596830-87596852 ATGCAAGTCCATAATCCAGTGGG + Intergenic
958151671 3:89700611-89700633 ATGCAACTCTGAAAGCCAATAGG + Intergenic
958175373 3:89989971-89989993 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
958463326 3:94426776-94426798 GTGCAAGTCCAAAATCCAATAGG - Intergenic
958475023 3:94569410-94569432 ATGCAAGTCCAAAACCTAACAGG - Intergenic
958537632 3:95424940-95424962 ATGCAAATCCAAAACCCAGTGGG + Intergenic
958582465 3:96044646-96044668 ATGCAAATCCAAAATCCAGTGGG + Intergenic
958588233 3:96118534-96118556 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
959141094 3:102487372-102487394 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
959267889 3:104167390-104167412 ATGCAAGTCCAAAGTCCAATGGG + Intergenic
959507995 3:107176678-107176700 ATGCAAGTCCAAAACCCAACAGG - Intergenic
959739978 3:109706708-109706730 ATGAAACTAGACAACCTAATTGG + Intergenic
959838540 3:110948784-110948806 ATGCAAGTCCAAAATCCAACAGG + Intergenic
959838938 3:110951658-110951680 ATGCAAATCCAAAACCCAGCAGG - Intergenic
959862501 3:111231554-111231576 AAGCACCTCTAAAACCCAATGGG - Intronic
959893591 3:111583167-111583189 ATGCAAGTCCAAAATCCAAAAGG + Intronic
959968476 3:112381981-112382003 ATGCAAGTCCAAAATCCATTGGG - Intergenic
960670901 3:120154676-120154698 GTGCAAGTCCAAAACCCAGTGGG + Intergenic
960858079 3:122123362-122123384 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
962035102 3:131643342-131643364 ATGCAAGTCCAAAATCCAAAAGG - Intronic
962067070 3:131992391-131992413 ATTCAAGTCCAAAATCCAATAGG - Intronic
962128913 3:132651762-132651784 ATGCAAGTCCAAAATCCAGTGGG - Intronic
962421519 3:135233327-135233349 ATGCAAGTCCAAAATCCAATGGG + Intronic
963386151 3:144597847-144597869 ATGCAAGTACAAAATCCAATAGG + Intergenic
963716761 3:148812110-148812132 ATGCAAGTCCAAAATCCAGTTGG - Intronic
963833683 3:150035004-150035026 ATGCAAATGAACATCCCAATGGG + Intronic
963996512 3:151716494-151716516 ATGCAAGTTCAAAACCCAATGGG + Intergenic
964241564 3:154600951-154600973 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
964324805 3:155534341-155534363 ATGCAAGTCCAAAATCCAACAGG - Intronic
964703956 3:159598463-159598485 ATGCATATCCACAATCCAGTGGG + Intronic
964853449 3:161119516-161119538 ATGCAAGTCCAAAACCCAGCAGG - Intronic
964897270 3:161613279-161613301 ATGCAACTCCAAAATTCAACAGG - Intergenic
964943530 3:162190547-162190569 ATGCTAATCCCCAACACAATAGG + Intergenic
965000356 3:162944974-162944996 AAGTAAGTCCACAACCCAACAGG - Intergenic
965108347 3:164387797-164387819 ATGCAAGTCCAAAATCCAACAGG + Intergenic
965305472 3:167058886-167058908 ATGCAAGTCCAAAATCCAATAGG + Intergenic
965500091 3:169445891-169445913 ATGCAAGTCCAAAATCCAGTGGG - Intronic
965662198 3:171053329-171053351 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
965929843 3:174029371-174029393 ATGCAAGTCCAAAATCCAATAGG - Intronic
966299503 3:178462422-178462444 ATGCAAGTCCAAAATCCATTGGG - Intronic
966302758 3:178497249-178497271 ATGCAAGTCCAAAACCCAGCAGG - Intronic
966314734 3:178632960-178632982 ATGCAAGTCCAAAATCCAATAGG + Intronic
966446495 3:180007214-180007236 ATGCAAGTCCAAAATCCAGTGGG + Intronic
967154918 3:186683512-186683534 ATGCAAGTCCAAAATCCAACAGG + Intergenic
967303013 3:188035283-188035305 ATGAAAATCAATAACCCAATAGG + Intergenic
967501658 3:190204469-190204491 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
967509350 3:190291832-190291854 ATGCAAGTCCAAAATCCAATAGG + Intergenic
967519790 3:190416280-190416302 ATGCAAGTCCAAAACCCAGTGGG + Intergenic
967559545 3:190901961-190901983 ATGCAACTCCAAAACCCAGAAGG - Intergenic
967622481 3:191650491-191650513 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
967776941 3:193394888-193394910 ATGCAAGTCCAAAATCCAGTCGG + Intergenic
968392303 4:203634-203656 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
968530588 4:1089313-1089335 ATGCAAGTCCAGAACCCAGCAGG - Intronic
968892788 4:3380159-3380181 ATGCAAGTCCAAAATGCAATAGG + Intronic
969128813 4:4975300-4975322 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
969176954 4:5406135-5406157 ATGCAAGTCCAAAACCCAGCAGG + Intronic
969190240 4:5512646-5512668 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
969960568 4:10940697-10940719 ATGCAAGTCCAAAATCCAATAGG - Intergenic
970003410 4:11387095-11387117 AAGCAAGTCCAAAACCCAACAGG - Intergenic
970317297 4:14841667-14841689 AAGTAACTCCAAAACCCAACAGG + Intergenic
970351620 4:15207222-15207244 ATGCAAGTCCAAAATCCAACAGG - Intergenic
970567856 4:17349964-17349986 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
970577652 4:17443773-17443795 ATGCAAATCCAAAACCCAGTGGG + Intergenic
970742133 4:19251044-19251066 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
970784820 4:19783362-19783384 ATGGAAGTCCAAAATCCAATAGG + Intergenic
971069894 4:23079715-23079737 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
971111660 4:23592264-23592286 ATGCAAGTCCAAAGTCCAATAGG - Intergenic
971561456 4:28084001-28084023 ATGAAAGTCCATAATCCAATAGG + Intergenic
971684393 4:29746305-29746327 ATGCAAGTCCAAAACCCAGAAGG + Intergenic
971863057 4:32133833-32133855 ATGCAATTCAACAGCACAATAGG + Intergenic
971912274 4:32809879-32809901 ATGCAAGTCCAAAATCCAATAGG + Intergenic
971962597 4:33508041-33508063 ATGCAAGTCCAAAATCCAATAGG - Intergenic
972014838 4:34231185-34231207 ATGCAAGTCCAAAATCCAAGAGG - Intergenic
972017310 4:34263079-34263101 ATGCAAGTCCAAAATCCAACAGG + Intergenic
972056126 4:34805735-34805757 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
972190726 4:36587623-36587645 ATGCAAGTCCAAAATCCAACAGG - Intergenic
972200033 4:36703189-36703211 ATGCAAGTCCAAAATCCAACAGG - Intergenic
972279709 4:37590366-37590388 CTGCCACTCCACAGCCCACTGGG + Exonic
972812379 4:42604534-42604556 ATACAACTCCACTACCTAGTAGG + Intronic
972844339 4:42970025-42970047 ATGCAAGTCCAAAACCCAGCAGG + Intronic
972878597 4:43396026-43396048 ATGCAAGTCCAAAACCCAGTAGG - Intergenic
972890807 4:43553995-43554017 ATGCAAGTCCAAAATCCAATAGG - Intergenic
973010806 4:45070208-45070230 ATGCAAGTCCAATACCCAGTAGG - Intergenic
973367011 4:49216019-49216041 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
973367408 4:49218895-49218917 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
973393612 4:49576386-49576408 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
974171428 4:58271181-58271203 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
974177718 4:58345378-58345400 ATGCAAGTCCAAAATCCAATGGG - Intergenic
974206179 4:58705655-58705677 ATGCAAATCCAAAATCCAACAGG - Intergenic
974214446 4:58827659-58827681 ATGCAAGTCCAAAATCCAATAGG + Intergenic
974485166 4:62494790-62494812 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
974555768 4:63445774-63445796 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
974651205 4:64755705-64755727 ATGCAAGTCTGAAACCCAATAGG - Intergenic
974726315 4:65803348-65803370 ATTCAACTTCACAAACCACTTGG + Intergenic
974779210 4:66529339-66529361 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
974842203 4:67310936-67310958 ATGCAAGTCCAAAATCCAATAGG - Intergenic
974915568 4:68174064-68174086 ATGCAAGTCCAAAATCCAATGGG - Intergenic
974997077 4:69174809-69174831 AGGCAACTCCAAAACCCAGCAGG + Intronic
975010042 4:69339772-69339794 AGGCAACTCCAAAACCCAGCAGG + Intronic
975115100 4:70671405-70671427 CTGCACATCCACAACCCAAGGGG - Intronic
975186590 4:71410435-71410457 ATGCAAGTCCAAAATCCAGTGGG - Intronic
975307415 4:72865807-72865829 AGGCAAGTCCAAAATCCAATAGG - Intergenic
975350363 4:73339256-73339278 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
975361232 4:73474652-73474674 ATGCAAGACCAAAATCCAATAGG + Intergenic
975897524 4:79111445-79111467 ATGCAACAATACAAACCAATGGG - Intergenic
976442346 4:85089600-85089622 ATGCAAGTCCAAAATCCAATTGG - Intergenic
976636053 4:87287276-87287298 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
976952541 4:90850580-90850602 ATGCAAGTCCAAAATCTAATAGG - Intronic
977005986 4:91570052-91570074 ATACAAGTCCAAAATCCAATAGG + Intronic
977050193 4:92119741-92119763 ATGCAAATCCAAAACCCAATGGG - Intergenic
977197438 4:94080939-94080961 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
977197806 4:94083684-94083706 TTGCAAGTCCAAAACCCAGTGGG + Intergenic
977356337 4:95952097-95952119 ATGCAAGTGCAAAATCCAATAGG + Intergenic
977579136 4:98705282-98705304 ATGCAAGTCCAAAATTCAATAGG - Intergenic
977703994 4:100051640-100051662 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
977821032 4:101472663-101472685 ATGCAAGTCCAAAATCCAACAGG - Intronic
977905106 4:102468067-102468089 AACCAAATCCAAAACCCAATAGG - Intergenic
977952760 4:102993328-102993350 ATGCAAGTCCGAAATCCAATAGG + Intronic
978145497 4:105366625-105366647 ATACAAGTCCAAAATCCAATAGG - Intergenic
978492382 4:109322940-109322962 ATGCAAGTCCAAAACCCAACAGG + Intergenic
979122516 4:116921048-116921070 ATGCAAGTCCAGAACCCAGCAGG - Intergenic
979136081 4:117114428-117114450 ATGCAAGCCCAAAATCCAATGGG + Intergenic
979139156 4:117150822-117150844 ATGCAAGTCTAAAACCCAATAGG + Intergenic
979699945 4:123656288-123656310 ATGCAATTCCAAAATCCAACAGG + Intergenic
979702980 4:123688928-123688950 ATGAAAATCCACAACCCAACAGG + Intergenic
980280014 4:130707068-130707090 ATGCAACTCCAAAATCCAATAGG + Intergenic
980579683 4:134733031-134733053 ATGAAACTCTAAAATCCAATAGG - Intergenic
980654531 4:135765533-135765555 ATGCAAGTCCGAAATCCAATAGG + Intergenic
980672402 4:136026419-136026441 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
980846677 4:138332955-138332977 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
981131452 4:141162281-141162303 ATGCAAGTCCAAAACCCAGCAGG - Intronic
981176790 4:141691612-141691634 ATGCAAGTCCAAAATCCAACAGG + Intronic
981275468 4:142893882-142893904 ATGCAAGTCCAAAACTCAACAGG - Intergenic
981643110 4:146967704-146967726 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
981861569 4:149362083-149362105 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
982392828 4:154884502-154884524 ATGCAATTCCACAATCCAGCAGG + Intergenic
982432482 4:155338540-155338562 ATGCAAGTCCAAAACCCAGAAGG - Intergenic
982477153 4:155867873-155867895 ATGCAAGTCTAAAATCCAATAGG + Intronic
982506105 4:156219327-156219349 ACGCAAGTCCAAAACCCAACAGG - Intergenic
982853252 4:160345820-160345842 ATGCTGCTCCACAAGACAATTGG - Intergenic
982868130 4:160543649-160543671 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
982904220 4:161048166-161048188 GTGCAAGTCCAAAATCCAATAGG + Intergenic
983015608 4:162608372-162608394 GTGCAAGTCCAAAACCCAACAGG - Intergenic
983132775 4:164042879-164042901 ATGCAAGTCCAAAACCCAGCAGG + Intronic
983322338 4:166211257-166211279 ATGCAAGTCCAAAATCCAATGGG + Intergenic
983322637 4:166213329-166213351 ATGCAAGTCCAAAATCCAATAGG + Intergenic
983437294 4:167731574-167731596 ATGCAAGTCCAAAATCCAATGGG - Intergenic
983478331 4:168242546-168242568 ATGCAAGTCCAAAATCCAGTGGG - Intronic
983644433 4:169975650-169975672 ATGTAACTCCATACCACAATAGG + Intergenic
983889567 4:173016534-173016556 ATGCAAGTCCAAAATCCAGTGGG - Intronic
984240187 4:177209090-177209112 ATGCAAATCCAAATCACAATGGG - Intergenic
984523905 4:180833494-180833516 ATGGAACTACACAACACAAAGGG - Intergenic
984571852 4:181404322-181404344 ATGAAAGTTCACAACCCAGTAGG + Intergenic
985047874 4:185958695-185958717 AGGCAACTCCATAACACACTTGG - Intergenic
985193795 4:187406499-187406521 AAGAAACTCCACAAACTAATGGG - Intergenic
985431755 4:189887969-189887991 ATGCAAGTCCAAAATTCAATGGG + Intergenic
1202764511 4_GL000008v2_random:138536-138558 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
985474196 5:69003-69025 ATGCAAGTCCAAAATCCAATAGG - Intergenic
986138503 5:5006316-5006338 ATACAAGTCCAAAATCCAATAGG - Intergenic
986472900 5:8093728-8093750 ATGCAAGTCTTCAACCCAACAGG + Intergenic
986533458 5:8762261-8762283 ATGCAAGTCCAAAATCCAAAAGG - Intergenic
986582418 5:9279253-9279275 ATGCAAGTCCAAAACCCAGCAGG - Intronic
986900259 5:12422218-12422240 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
986904942 5:12485125-12485147 ATGCAAGTTCAAAACCCAACAGG + Intergenic
986933905 5:12859138-12859160 ATCCAAGTCCAAAATCCAATAGG - Intergenic
987003856 5:13689087-13689109 ATGCAAGTCCAAAACCCAAGAGG - Intergenic
987191026 5:15478457-15478479 ATGCAAGTTCAAAATCCAATGGG - Intergenic
987252345 5:16112431-16112453 ATGCAAGTCCAGAATCCAGTGGG - Intronic
987455323 5:18138092-18138114 ATGCAAATCTAAAATCCAATAGG + Intergenic
987509248 5:18814855-18814877 ATGCAAGTCCAGAATCCAGTGGG + Intergenic
987531738 5:19130348-19130370 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
987658488 5:20839852-20839874 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
987708959 5:21485579-21485601 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
988379348 5:30480648-30480670 ATGCAAGTCCAAAATCCAATAGG + Intergenic
988394572 5:30680243-30680265 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
988579724 5:32458492-32458514 ATACGATTCCAAAACCCAATGGG + Intergenic
988750655 5:34188567-34188589 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
988765197 5:34366092-34366114 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
988911140 5:35845311-35845333 ATGCAAGTCCAAAATCCAAGAGG + Intergenic
989032740 5:37136272-37136294 ATACAAGTCCAAAATCCAATAGG + Intronic
989067718 5:37480988-37481010 ATGCAAGTCCAAAACCCAGCAGG + Intronic
989132717 5:38123859-38123881 ATGCAAATCCAAAATCCAATAGG + Intergenic
989254354 5:39350623-39350645 ATGCAAGTCCAAAACCCAGTTGG + Intronic
989656696 5:43752988-43753010 ACGCAATTCCAAAATCCAATAGG + Intergenic
989735131 5:44694385-44694407 CTGCAACTCCCAAACCCAAATGG - Intergenic
989746909 5:44839842-44839864 ATGCAAGTCCAAAACCCAGTGGG - Intergenic
990108367 5:52292779-52292801 ATGCAAGTCCAAAATCCAATGGG + Intergenic
990143444 5:52731578-52731600 ATGTAAATCCAAAATCCAATAGG - Intergenic
990193229 5:53285902-53285924 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
990429235 5:55718097-55718119 ATGCAAGTCCAAAATCCAGTGGG - Intronic
990794591 5:59525336-59525358 ATGCAAGTCCAAAATCCAATAGG - Intronic
990830490 5:59951778-59951800 ATCCAACTCTACAACCCAGTGGG + Intronic
990903512 5:60778984-60779006 ATGCAAGTCCAAAATCCAGTAGG + Intronic
990941387 5:61206174-61206196 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
991039257 5:62159192-62159214 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
991735796 5:69630492-69630514 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991738924 5:69651780-69651802 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991759274 5:69904651-69904673 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
991788062 5:70213471-70213493 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991790499 5:70231521-70231543 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991812290 5:70486131-70486153 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991815249 5:70506608-70506630 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991818385 5:70527897-70527919 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991838503 5:70779717-70779739 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
991880509 5:71213835-71213857 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991882946 5:71231856-71231878 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
992004834 5:72467199-72467221 ATGCATCACCCAAACCCAATAGG + Intronic
992651472 5:78864832-78864854 ATGCAAGTCCAAAATCCAGTGGG + Intronic
992954271 5:81891413-81891435 ATGCAAGTCTGAAACCCAATGGG - Intergenic
993164181 5:84331022-84331044 ATGCAAGTCCAATATCCAATAGG - Intronic
993293886 5:86109558-86109580 ATGCAAGTCCACAATCCAACGGG - Intergenic
993561738 5:89418307-89418329 ATGCAAGTCCAAAATCCAATAGG - Intergenic
993581038 5:89661281-89661303 ATGCAAGTCCAAAACACAACAGG - Intergenic
993638170 5:90370831-90370853 ATGCAAGTCCAAAATTCAATGGG + Intergenic
993703964 5:91148935-91148957 ATGCAAGTCCAAAATCCAATAGG - Intronic
993711490 5:91229944-91229966 ATCCAAGTCCAAAATCCAATAGG + Intergenic
993743243 5:91564926-91564948 ATGCAAGTCCAAAGTCCAATGGG + Intergenic
993792478 5:92224152-92224174 ATGCATGTCCAAAATCCAATAGG + Intergenic
993801860 5:92352012-92352034 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
993893632 5:93505145-93505167 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
994019049 5:95002570-95002592 ATACAAGTCCAAAATCCAATAGG - Intronic
994073666 5:95628450-95628472 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
994421080 5:99526924-99526946 ATGCAAATCCAAAACCCAGCAGG + Intergenic
994485961 5:100387390-100387412 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
994549221 5:101209090-101209112 ATGGAAGTCCAAAACCCAGTGGG - Intergenic
994764611 5:103900569-103900591 ATGCAAGTCCAAAATCCAATAGG - Intergenic
995559371 5:113364294-113364316 ATGCAAGTCCAAAACCCAGCAGG + Intronic
996011167 5:118483224-118483246 ATGCAAGTCCAAAATCCAACAGG + Intergenic
996046684 5:118882180-118882202 ATGCAAGTCCAAAACCCAGCTGG + Intronic
996222889 5:120954267-120954289 ATGCAAGTCCAAAATCCAGTTGG - Intergenic
996453631 5:123655841-123655863 ATGCAAGTCCAAAGCCCAGTGGG + Intergenic
996651485 5:125882329-125882351 ATGCAACTCCCCCACTCAAAAGG + Intergenic
997016159 5:129937747-129937769 ATGCAAGTCTACAACCCAGCAGG + Intronic
997093039 5:130878993-130879015 ATGCAAATCCAAAATCCAGTGGG - Intergenic
998697024 5:144652370-144652392 ATGCAAGTCTACAATCCAATAGG + Intergenic
998756872 5:145390908-145390930 ATGCAAGTCCAAAATCCAATAGG + Intergenic
999906231 5:156143679-156143701 ATGCAAGTCCAAAACCCAGCAGG - Intronic
1000270420 5:159678679-159678701 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1000515928 5:162236449-162236471 ATGCAAATCCAAAATCCAGTGGG + Intergenic
1000574993 5:162966322-162966344 ATGCAAGTCCAAACCCCAACAGG + Intergenic
1000694129 5:164358899-164358921 AAGTAAGTCCAAAACCCAATGGG - Intergenic
1000728401 5:164801180-164801202 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1001194816 5:169663128-169663150 ATGCAAGTCCAAAACCCAGCTGG + Intronic
1001258461 5:170204002-170204024 ATGCACCTCCACAATGCTATGGG - Intergenic
1001943913 5:175761688-175761710 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1002869906 6:1157288-1157310 ATGCAAGTCCAACATCCAATAGG - Intergenic
1003000307 6:2325618-2325640 ATGCAAGTCCAAAACCCAGAAGG - Intergenic
1003484342 6:6562904-6562926 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1004355686 6:14928249-14928271 CAGGAACTCCACACCCCAATTGG + Intergenic
1004565096 6:16788868-16788890 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1004592873 6:17070424-17070446 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1005548727 6:26894872-26894894 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1005984056 6:30859549-30859571 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1006803858 6:36776377-36776399 ATGCATCTCCACACTCCAGTGGG - Intronic
1008337421 6:50324253-50324275 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1008571494 6:52821373-52821395 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1009019481 6:57935984-57936006 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1009242516 6:61199236-61199258 ATGCAAGTCCAAAATACAATAGG - Intergenic
1009652920 6:66499391-66499413 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1009757390 6:67956906-67956928 ATGCAAATCCAAAATCCAATAGG - Intergenic
1009804865 6:68590275-68590297 ATGCAACTCCAAAATCCAATAGG + Intergenic
1010527816 6:76924892-76924914 ATGCAAATCCAAAACCCAGCAGG - Intergenic
1010981645 6:82376184-82376206 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1011088750 6:83571490-83571512 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1011347766 6:86390286-86390308 ATGCAAGTCCAAAGTCCAATAGG - Intergenic
1011870532 6:91886724-91886746 CTGCAAGTCCACAATCCAATAGG - Intergenic
1011981629 6:93386365-93386387 ATGCAGGTCCAAAATCCAATAGG + Intronic
1012064817 6:94537121-94537143 ATGCAAGTACAAAATCCAATAGG + Intergenic
1012126033 6:95428887-95428909 ATGCAAATTCAAAATCCAATAGG - Intergenic
1012141090 6:95627830-95627852 TTGCAATTCCACACCACAATGGG + Intergenic
1012240003 6:96860638-96860660 ATGCAAATCCAAAATCCAGTGGG - Intergenic
1012349374 6:98232330-98232352 ATGCAACTCCAAAACCCAGGAGG + Intergenic
1012478115 6:99637003-99637025 ATGCAAGTCCAAAATCCAATGGG + Intergenic
1012597293 6:101055039-101055061 ATGCAACTTCAATACCCAACAGG + Intergenic
1012771076 6:103436204-103436226 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1013213604 6:108007930-108007952 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1013717265 6:112976549-112976571 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1013928675 6:115503245-115503267 GTGCAAGTCCAAAATCCAATAGG - Intergenic
1014075542 6:117230626-117230648 TTGCAAGTCCAAAACCCAGTAGG + Intergenic
1014668775 6:124272878-124272900 ATGCAAGTTCAAAACCCAGTAGG - Intronic
1014730884 6:125030554-125030576 ATGCAAGTCCAAAATCCAGTAGG + Intronic
1014875657 6:126655528-126655550 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1014895285 6:126893257-126893279 ATGCAAGTCCGAAATCCAATAGG - Intergenic
1014951277 6:127558684-127558706 ATAAAAGTCCAAAACCCAATGGG - Intronic
1014977940 6:127912180-127912202 ATGCAAGTCTAAAATCCAATAGG - Intronic
1015377944 6:132532007-132532029 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1015652580 6:135479462-135479484 ATGCAAGTCCAGAACCCAGCAGG - Intronic
1015713048 6:136162814-136162836 ATGCAAGTCCAAAATCCAATAGG + Intronic
1015815745 6:137209069-137209091 ATGCAAGTCCATAATCCAGTGGG - Intronic
1015901822 6:138075491-138075513 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1016166077 6:140945273-140945295 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1016175303 6:141072114-141072136 ATGCAAGCCCAAAATCCAATAGG - Intergenic
1016241313 6:141934750-141934772 ATCCAAGTCCAAAATCCAATAGG - Intergenic
1016437046 6:144048047-144048069 ATGCAAGTCCAAAATCCAAGGGG + Intronic
1016564768 6:145440698-145440720 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1016721626 6:147304810-147304832 ATGCAAATCCAAAATCCAAAAGG - Intronic
1016987964 6:149909298-149909320 ATGCAAGTCCAAAACCCAGTGGG - Intergenic
1017375454 6:153762589-153762611 ATGCAAGTCCAAAAGCCAACAGG + Intergenic
1018507041 6:164482991-164483013 ATGCAAGTCCAGAACCCAATGGG + Intergenic
1018510160 6:164516405-164516427 ATGCAAGTACAAAATCCAATAGG + Intergenic
1018527537 6:164729356-164729378 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1018566800 6:165163100-165163122 ATACAAGTTCACAATCCAATAGG + Intergenic
1018721654 6:166577537-166577559 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1019150351 6:170001369-170001391 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1019199230 6:170300742-170300764 ATGCAAGTCCAAAATCCAATAGG + Intronic
1019950356 7:4367304-4367326 ATGCAACTACTCAACCCCAGGGG + Intergenic
1020611224 7:10400852-10400874 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1021036768 7:15809527-15809549 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1021762345 7:23913878-23913900 ATACAAGTCCAAAATCCAATAGG - Intergenic
1022549787 7:31227805-31227827 ATGCAAGTCCAAAACCCAGCGGG - Intergenic
1022705925 7:32802078-32802100 ATGCACATCCGAAACCCAATAGG + Intergenic
1022735356 7:33070829-33070851 ATGCAAGTCCAAAACCCAGTAGG - Intergenic
1022910498 7:34895985-34896007 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1023188449 7:37554783-37554805 ATGCAAGTCCAAAGCCCAGTAGG + Intergenic
1023236935 7:38099586-38099608 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1023669442 7:42560581-42560603 ATGCAAGTCCAAAACCCAGCGGG - Intergenic
1023690372 7:42779750-42779772 ATGCAAGTCCAAAACCCACCAGG - Intergenic
1024667339 7:51559837-51559859 ATGCAAGTCCAAAATCCAACAGG - Intergenic
1024814920 7:53257276-53257298 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1024912230 7:54458616-54458638 ATTCAAGTCCAAAATCCAATAGG - Intergenic
1025038634 7:55619722-55619744 ATGCAAACCCAAAATCCAATAGG - Intergenic
1027341069 7:77209296-77209318 ATGCAAATCCAAAACCCAGCAGG + Intronic
1027958967 7:84919449-84919471 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1027996836 7:85435075-85435097 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1028045136 7:86108199-86108221 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1028099158 7:86798443-86798465 ATGCAAGTCCAAAATCCAGTAGG - Intronic
1028286688 7:89011611-89011633 ATGCAACTCCACAACCCAATAGG + Intronic
1028301362 7:89205541-89205563 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1028314559 7:89384131-89384153 ATGCAAGTCCATAATCCAGTGGG - Intergenic
1028784313 7:94774350-94774372 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1028844224 7:95461400-95461422 ATGCAAGTCCGAAATCCAATAGG - Intergenic
1029952678 7:104603741-104603763 AAGCAAGTTCAAAACCCAATAGG + Intronic
1030415553 7:109238677-109238699 ATGCAAATCCAAAATCCAATAGG - Intergenic
1030516913 7:110550386-110550408 ATGCAAATCCAAAACCCAGAAGG + Intergenic
1030572239 7:111242352-111242374 CTGCAATTCCACAAACAAATTGG - Intronic
1030809829 7:113958848-113958870 ATGCAAGTCCAAAATCCAACAGG + Intronic
1030829888 7:114208282-114208304 ATGCAAGTCCAAAATCCAGTAGG - Intronic
1031182244 7:118433376-118433398 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1031238744 7:119211352-119211374 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1031249055 7:119356675-119356697 ATGAAAGTCCAAAATCCAATGGG + Intergenic
1031288871 7:119907692-119907714 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1031301674 7:120068540-120068562 ATGCAAGTACAAAATCCAATGGG - Intergenic
1031562847 7:123258857-123258879 AAGCAACTCAACAGCCCAAGAGG + Intergenic
1033249170 7:139744047-139744069 ATGCAAATCAAAAACACAATGGG + Intronic
1033837681 7:145335415-145335437 ATGCAAGTCCAAAATTCAATAGG + Intergenic
1033953392 7:146813436-146813458 ATGCAACTCTGAAATCCAATAGG - Intronic
1034710310 7:153185424-153185446 ATGCAAGTTCAAAACCCAACAGG + Intergenic
1034739759 7:153462906-153462928 ATGCAAGTCCAAAACCCAACAGG - Intergenic
1034874442 7:154713093-154713115 ATGCATGTCCAAAATCCAATAGG + Intronic
1035180403 7:157085194-157085216 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1036106412 8:5845689-5845711 TTGCAAGTCCAAAACCTAATAGG + Intergenic
1037206082 8:16321292-16321314 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1037415306 8:18643617-18643639 ACCCAACTCCAAAACCAAATAGG + Intronic
1038456876 8:27678556-27678578 AAACAACTCCACACCCAAATAGG + Intergenic
1039652212 8:39353989-39354011 ATGCAAGTCCAAAATCCATTGGG - Intergenic
1040741406 8:50580170-50580192 ATGCAAGTCCAAAATCCAATAGG - Intronic
1040945863 8:52883466-52883488 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1041013911 8:53571691-53571713 ATGCAAGTCCAAAACCCACAGGG - Intergenic
1041223014 8:55670591-55670613 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1041823823 8:62068772-62068794 ATGCAAGTTCAAAATCCAATGGG - Intergenic
1041902420 8:62996748-62996770 ATGCAAGTCCAAAACCTGATGGG + Intronic
1041927669 8:63252979-63253001 ATGCAAGTCCAAAACCCAGTGGG - Intergenic
1042057911 8:64786431-64786453 ATGCAAGTCCAAAAACCAATAGG + Intronic
1042407471 8:68422386-68422408 ATGCAAGTCCGAAATCCAATAGG + Intronic
1042605531 8:70541993-70542015 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1042772873 8:72398459-72398481 ATTCAAGTCCAAAATCCAATGGG + Intergenic
1043080675 8:75761206-75761228 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1043518631 8:81020035-81020057 ATGCAAGTCCAAAATTCAATAGG - Intronic
1043644414 8:82499228-82499250 ATGCAAGTCCAAAATGCAATAGG - Intergenic
1043660685 8:82736578-82736600 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1044082551 8:87903750-87903772 ATGCAAGTCTGAAACCCAATAGG + Intergenic
1044279797 8:90341464-90341486 ATGCAACTCCACAATCCAGTGGG - Intergenic
1044496837 8:92896702-92896724 AAGCAAGTCCAAAACCCAACAGG - Intronic
1044760637 8:95514091-95514113 ATGCAAGTCCAAAATCCACTGGG + Intergenic
1044886292 8:96781880-96781902 AAGTAAGTCCAAAACCCAATGGG + Intronic
1045115708 8:98977929-98977951 AAGAAAGTCCAAAACCCAATAGG + Intergenic
1045735948 8:105296564-105296586 ATGCAAATCCAAAATCCAGTAGG + Intronic
1045884345 8:107078423-107078445 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1045993651 8:108338859-108338881 ATGCAAGTCCAAAACCCAGTGGG + Intronic
1046180082 8:110633618-110633640 ATGCAAGTCCAAAATTCAATAGG - Intergenic
1046243692 8:111531721-111531743 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1046311171 8:112440228-112440250 ATGCAAGTTCAAAATCCAATAGG + Intronic
1046433062 8:114153429-114153451 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1046481178 8:114821021-114821043 ATGCAAGTCCAAAACCTAAGAGG + Intergenic
1046492273 8:114968220-114968242 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1046600773 8:116314896-116314918 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1047149228 8:122241734-122241756 ATGCAAGTCCAAAATCCATTGGG - Intergenic
1047917977 8:129603436-129603458 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1048107431 8:131427164-131427186 ATCCAAGTCCAAAATCCAATGGG + Intergenic
1048365326 8:133733282-133733304 GTGCGACTCCACTACCCAACTGG + Intergenic
1048669147 8:136696508-136696530 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1048729117 8:137418396-137418418 ATGCAAGTCCAAAAGCCAAAAGG + Intergenic
1048745961 8:137615412-137615434 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1048772703 8:137912559-137912581 ATGCAAATCCAAAATCCAGTGGG + Intergenic
1050109461 9:2199970-2199992 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1050121633 9:2314328-2314350 ATGCAAGTCCTAAATCCAATAGG - Intergenic
1050156068 9:2667406-2667428 ATGCAAATCCAAAATCCAGTGGG - Intergenic
1051250305 9:15152272-15152294 CTGCAGCTCCAAAACCAAATGGG + Intergenic
1051967312 9:22844794-22844816 ATGCAAGTCCAAAAACCAATGGG + Intergenic
1051984193 9:23063280-23063302 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1051986665 9:23097055-23097077 ACGCAAGTCCAAAATCCAATAGG - Intergenic
1052080883 9:24203886-24203908 ATGCAAGTCCAAAATCCAATGGG - Intergenic
1052179303 9:25505154-25505176 ATGCAAGTCCAAAACCCACCAGG + Intergenic
1052665989 9:31496310-31496332 ATGCAAATCCAAAATCCAAAGGG + Intergenic
1052689784 9:31802420-31802442 ATGCAAATCCAAAACCCAGCAGG - Intergenic
1052705336 9:31988177-31988199 ATGCAAATCCAAAATCCAGTGGG + Intergenic
1052880131 9:33596730-33596752 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1053264168 9:36698536-36698558 ATGCAAGTCCAAAACCCAACAGG + Intergenic
1053371413 9:37564654-37564676 ATGCAAGTCCAAAATCCAATAGG - Intronic
1053495845 9:38547488-38547510 ATGCAAGTCCAAAACCCAGGAGG + Intronic
1053665455 9:40314432-40314454 ATGCAAGTCCAAAACCCAGCAGG - Intronic
1053665930 9:40317520-40317542 ATGCAAGTCCAAAACCCAGGAGG - Intronic
1053720922 9:40946008-40946030 ATGCAAGTCCAAAATTCAATGGG + Intergenic
1053914096 9:42932074-42932096 ATGCAAGTCCAAAACCCAGAAGG - Intergenic
1053915047 9:42939479-42939501 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1053915508 9:42942565-42942587 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1054345071 9:63906148-63906170 ATGCAAGTCCAAAATTCAATGGG - Intergenic
1054376608 9:64454462-64454484 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1054377084 9:64457548-64457570 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1054518681 9:66058763-66058785 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1054825065 9:69565489-69565511 ATGGAACTTCATACCCCAATAGG + Intronic
1055334907 9:75223849-75223871 ATGCAAGTCCAAAACCCAGAAGG + Intergenic
1055467907 9:76583542-76583564 AAGCAAGTCCACAACGCAAGAGG + Intergenic
1055701350 9:78948609-78948631 ATGCAAGTCCAAAATCCAAAGGG - Intergenic
1055848404 9:80594897-80594919 ATGGAAGTCCAAAATCCAATAGG - Intergenic
1055886015 9:81063765-81063787 ATGCAACTCAGAAATCCAATAGG - Intergenic
1056434896 9:86566269-86566291 ATGCAAGTCCAAAACCCAGATGG + Intergenic
1056585956 9:87927303-87927325 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1056610928 9:88125640-88125662 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1056742912 9:89275610-89275632 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1057316391 9:93971575-93971597 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1057542339 9:95987460-95987482 ATGCAAGTCCAGAATCCAGTGGG + Intronic
1058076601 9:100657678-100657700 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1058101874 9:100925410-100925432 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1058210390 9:102161097-102161119 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1058309803 9:103485943-103485965 ATGCAATTCCAAAACCCAACAGG - Intergenic
1058385429 9:104429867-104429889 ATGCAAATCCAAAACCCAGCAGG - Intergenic
1058831669 9:108823381-108823403 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1059513928 9:114875579-114875601 ATACAAGTCCAAAATCCAATAGG + Intergenic
1061603195 9:131686470-131686492 ATGCAGCTCCACTACACAACTGG + Intronic
1203545260 Un_KI270743v1:123423-123445 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1203546143 Un_KI270743v1:129794-129816 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1186222793 X:7367081-7367103 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1186266557 X:7840195-7840217 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1186488486 X:9952716-9952738 ATGCAAGTCCGAAACCCAACAGG + Intergenic
1186992524 X:15084987-15085009 ATGCAAGTCCAAAATCCAACAGG - Intergenic
1187574835 X:20542914-20542936 ATGCAATTCCAAAATCCAATAGG - Intergenic
1187603834 X:20861874-20861896 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1188134972 X:26483929-26483951 ATGCAAGTACAAAATCCAATAGG - Intergenic
1188865238 X:35305874-35305896 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1188873059 X:35398100-35398122 ATGCAATTCCAAAATCCAGTGGG + Intergenic
1188889769 X:35595541-35595563 ATTCAAGTCCAAAATCCAATAGG - Intergenic
1189071226 X:37866215-37866237 ATGCAAGTCCGAAATCCAATAGG + Intronic
1189652837 X:43208587-43208609 ATGCAAGTCCAAAACCCAACAGG - Intergenic
1189788788 X:44583781-44583803 ATGCAAGTCCAAAATACAATAGG - Intergenic
1189815849 X:44823488-44823510 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1190514377 X:51207480-51207502 ATGCAAGTCCGAAATCCAATAGG - Intergenic
1191052225 X:56206497-56206519 ATGAAAGTCCAAAATCCAATGGG + Intergenic
1191083983 X:56545224-56545246 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1191170985 X:57447126-57447148 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1191689840 X:63928167-63928189 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1191696659 X:63997072-63997094 ATGCAAGTCCAAAATCCAATGGG - Intergenic
1191697603 X:64005752-64005774 ATGCAAGTCCAAAATCAAATAGG + Intergenic
1191802211 X:65093611-65093633 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1191873414 X:65769566-65769588 ATGCAAGTCCATAACCCAGCAGG - Intergenic
1191887043 X:65899387-65899409 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1192661166 X:73044463-73044485 AAGAAAAGCCACAACCCAATGGG - Intergenic
1192887224 X:75348096-75348118 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1192967527 X:76195185-76195207 ATGCAAATCCAAAATCCAATAGG + Intergenic
1193029044 X:76878605-76878627 ATGCAAGTCCAAAACCCAGAAGG + Intergenic
1193188224 X:78538700-78538722 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1193195982 X:78631920-78631942 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1193273405 X:79555290-79555312 ATGCAATTCCAAAATCCAATAGG - Intergenic
1193279433 X:79629113-79629135 ATGCAATTCCAAAATCCAGTGGG - Intergenic
1193333011 X:80256497-80256519 ATGCAAGTCCATAACCCAGTGGG - Intergenic
1193490356 X:82142314-82142336 AAGCAACTCAACAACCAAATAGG - Intergenic
1193503485 X:82309771-82309793 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1193519521 X:82511929-82511951 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1193678163 X:84482955-84482977 ATGCAAGTTCAAAATCCAATAGG + Intronic
1193686303 X:84580605-84580627 ATGCAAGTCCAAAACCCAATAGG - Intergenic
1193795368 X:85866797-85866819 ATGCAAGTCCAAAACCCAGCCGG - Intronic
1193840625 X:86404437-86404459 ATGCAAGTCCAAAATCCAATAGG + Intronic
1193864995 X:86720455-86720477 ATACAAGTCCGCAATCCAATAGG + Intronic
1193891039 X:87046225-87046247 AAGCAAGTCCAAAATCCAATAGG - Intergenic
1194043269 X:88970154-88970176 ATGCATGTCCAAAACCCAACAGG + Intergenic
1194054629 X:89116795-89116817 ATGCAAGTCCAGAATCCATTAGG + Intergenic
1194064255 X:89242042-89242064 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1194084113 X:89505321-89505343 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1194215726 X:91128522-91128544 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1194281775 X:91962355-91962377 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1194331014 X:92582912-92582934 ATGCAATTCCAGAATCCAGTGGG - Intronic
1194505545 X:94729638-94729660 ATGCAATTCCAAAATCCAACAGG + Intergenic
1194522537 X:94936248-94936270 ATGCAAGTCCAAAATCCAATGGG - Intergenic
1194563047 X:95446939-95446961 ATGCAAGTCCAAAACCCAGCTGG + Intergenic
1194616438 X:96109712-96109734 AAGCAAGCCCACAACCCAACAGG + Intergenic
1194688634 X:96955690-96955712 ATGCAAGTCTAAAATCCAATAGG + Intronic
1195536377 X:106013249-106013271 ATGCAAGTTCAAAATCCAATAGG - Intergenic
1195814147 X:108867286-108867308 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1195816841 X:108897153-108897175 ATGCAAGTCCAAAATCTAATAGG - Intergenic
1195838903 X:109150514-109150536 ATGCAAGTCCAAAATCCAACAGG - Intergenic
1196390569 X:115203617-115203639 ATGCAAGTCCAAAATACAATGGG + Intronic
1196559380 X:117127080-117127102 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1196565292 X:117197323-117197345 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1196565998 X:117206179-117206201 ATGCAAGTCCATAATCCAGTGGG + Intergenic
1196582472 X:117393579-117393601 ATGCAATTCCAAAACCCATCAGG + Intergenic
1196903454 X:120409500-120409522 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1197109413 X:122755530-122755552 ATGCAAGTCCAAATTCCAATAGG + Intergenic
1197440637 X:126485172-126485194 GAGCAAGTCCAAAACCCAATAGG + Intergenic
1197441355 X:126494813-126494835 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1197464356 X:126784588-126784610 ATGCAAGTCCGAAATCCAATAGG - Intergenic
1197526955 X:127575843-127575865 ATGAAAGTCCAAAATCCAATAGG + Intergenic
1197546979 X:127837940-127837962 ATGCAAGTCCAAAATCCACTGGG + Intergenic
1197561171 X:128024238-128024260 ATGCAAGTCCAGAATCCAGTAGG + Intergenic
1197856520 X:130919166-130919188 ATGCAAGTCCAAAATCCAACAGG + Intergenic
1198274747 X:135089936-135089958 ATGCAAGTCCGAAATCCAATAGG - Intergenic
1198566141 X:137907196-137907218 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1198629188 X:138616329-138616351 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1199003096 X:142663405-142663427 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1199063682 X:143389177-143389199 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1199070341 X:143468685-143468707 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1199078678 X:143552096-143552118 ATGCAAATCCAAAACCCAGCAGG - Intergenic
1199083773 X:143606355-143606377 ATGCAAGTCCAAAACCCAGTGGG - Intergenic
1199193366 X:144997776-144997798 GTGCAAGTCCAAAACCCAATAGG - Intergenic
1199258828 X:145747761-145747783 ATGCAAGTCCAAAATCCAATAGG + Intergenic
1199306262 X:146270303-146270325 ATGCAAGCCCAAAACACAATAGG - Intergenic
1199309647 X:146307906-146307928 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1199476813 X:148255013-148255035 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1199619487 X:149686497-149686519 ATGCAAGTCCAAAATCCAATAGG - Intergenic
1199806416 X:151305194-151305216 ATGCAAGTCCAAAACCCAGTAGG + Intergenic
1200008161 X:153101650-153101672 AAGCAAGTCCAAAACCCAACAGG + Intergenic
1200255800 X:154582113-154582135 ATGCAAGTCCAAAACCCAACAGG - Intergenic
1200261969 X:154622290-154622312 ATGCAAGTCCAAAACCCAACAGG + Intergenic
1200353831 X:155526826-155526848 ATGCAAGTTCAAAACCCAACAGG - Intronic
1200380796 X:155835044-155835066 ATGCAAGTCCAAAATCCAATGGG - Intergenic
1200436756 Y:3161207-3161229 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1200599369 Y:5187008-5187030 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1200615033 Y:5368910-5368932 ATGCAAATCCGAAATCCAATGGG - Intronic
1200718428 Y:6576141-6576163 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1201597406 Y:15686520-15686542 ATGCAAATCAAAACCCCAATGGG + Intergenic