ID: 1028287368

View in Genome Browser
Species Human (GRCh38)
Location 7:89019554-89019576
Sequence TATCCAATTCTGAAAGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 427}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028287368 Original CRISPR TATCCAATTCTGAAAGTTGT GGG Intronic
904840211 1:33367739-33367761 CATCCAATCCTGAAAGTGTTGGG - Intronic
907191122 1:52649846-52649868 TATCCTTTTCTGAAAGTTGTTGG + Intronic
908055047 1:60276858-60276880 TATGAATTTCTGAAAGTTTTTGG - Intergenic
908641847 1:66232585-66232607 TTTCCAATTCTAAATGTTGGAGG - Intronic
909207556 1:72778877-72778899 AATCCATTTCTGACAGTTCTAGG + Intergenic
909784074 1:79587548-79587570 TATCTCATTCTGAAAGTGATTGG - Intergenic
912442243 1:109708048-109708070 TAGCCAATTTCGAAAGTTCTGGG - Intronic
912961549 1:114200412-114200434 TTTCCATTTTTGAAATTTGTGGG - Intergenic
913231545 1:116744388-116744410 TTTCCCATCCTGGAAGTTGTAGG - Intergenic
914298268 1:146351618-146351640 TATATAATTCTGACAGTTTTAGG + Intergenic
914638361 1:149576911-149576933 TATATAATTCTGACAGTTTTAGG - Intergenic
914737873 1:150435970-150435992 TATACAATTCTGAAAATCCTAGG + Intronic
914885788 1:151583259-151583281 TATCTACTTCTCAAGGTTGTAGG - Exonic
916806694 1:168267073-168267095 TAGCCAATTCTGTAACTTCTAGG + Intergenic
917020314 1:170579632-170579654 TATCCAAGTTTAAAAGTGGTGGG + Intergenic
918927101 1:190801849-190801871 TATCTCATTCTAAAAGTTATTGG + Intergenic
924012132 1:239676811-239676833 TTTCAAATTCTGAAAATTCTTGG + Intronic
1063177199 10:3562128-3562150 TCTCCATTTCCTAAAGTTGTGGG - Intergenic
1064847991 10:19677600-19677622 TCTCCCATTCTGTAGGTTGTCGG + Intronic
1066096050 10:32072902-32072924 TATCCAACTGTGAAAGGTGAGGG + Intergenic
1067924984 10:50499290-50499312 TATCCATTTCTTAAAGTTCTTGG + Intronic
1069666069 10:70159953-70159975 TATCCATTTCAGACAGTTGGTGG - Intronic
1070358716 10:75665788-75665810 TTTACAAGTCTGTAAGTTGTAGG + Intronic
1072353986 10:94587905-94587927 CATCTCATTCTAAAAGTTGTGGG + Intronic
1072873911 10:99151442-99151464 TATCAAATTTTGAATGTTTTTGG - Intronic
1074940276 10:118229639-118229661 TTTTCATTTTTGAAAGTTGTTGG - Intergenic
1075011564 10:118874764-118874786 TATCCAATCCGGAAAGGTCTTGG - Intergenic
1076809070 10:132877395-132877417 TATCCACTTCTCAAAGTGCTGGG - Intronic
1080104851 11:28501210-28501232 TATTCAATTCTAAAGGTAGTAGG - Intergenic
1081186200 11:40045672-40045694 TTTACCATTCTGAAAATTGTAGG - Intergenic
1086356384 11:86005447-86005469 TATCTACTTCCGAAAGTTTTGGG - Intronic
1086496989 11:87414497-87414519 TCTCCCATTCTGTATGTTGTTGG - Intergenic
1087414041 11:97829868-97829890 TCTCCCATTCTGTATGTTGTTGG - Intergenic
1087416830 11:97867186-97867208 TTTCCCATTCTGTAGGTTGTGGG + Intergenic
1087480620 11:98695238-98695260 TATCAAATTCTCAAATATGTTGG + Intergenic
1087620528 11:100536278-100536300 TATCTAAGTCTGAAAATGGTGGG - Intergenic
1087680429 11:101213600-101213622 TAGCCAATTTTCAAAGTTCTGGG + Intergenic
1090263256 11:125337976-125337998 TCTCCAATTCTGGAAGCAGTGGG - Intronic
1091361723 11:134983362-134983384 TGTCCAATTCACAAAATTGTCGG - Intergenic
1093671738 12:21884466-21884488 TCTAGAATTGTGAAAGTTGTTGG + Intronic
1096527097 12:52216814-52216836 TTTCCATTTTTGAAATTTGTAGG + Intergenic
1096600685 12:52726399-52726421 TATACAATTCAGAAAGTTCTTGG + Intergenic
1097366384 12:58718235-58718257 GGGCCAATTCTGAAGGTTGTGGG + Intronic
1097502599 12:60424293-60424315 TATCTAACTCAGAAAGTTATTGG + Intergenic
1100094468 12:91015264-91015286 TCTCCCATTCTGTAGGTTGTCGG - Intergenic
1100094801 12:91020426-91020448 TTTCCAACTCTGACATTTGTTGG + Intergenic
1100558603 12:95723372-95723394 TTTACAACTCTGTAAGTTGTAGG + Intronic
1101884871 12:108653894-108653916 CATCTAATGCTGAAATTTGTTGG - Intronic
1102737133 12:115172279-115172301 TATCCAATTCTGAAGGTGCAGGG + Intergenic
1102879799 12:116475531-116475553 CATCCAATTCTGAGAATTGTTGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104551936 12:129765215-129765237 TCTACAACTCTGAAAGTTGTAGG + Intronic
1105393095 13:20000500-20000522 TTTACCATTCTGAAAATTGTAGG + Intronic
1105841755 13:24259771-24259793 AATCCAATTCAGAAAGGTTTCGG - Intronic
1107918889 13:45182870-45182892 AATCCATTTCTGAGACTTGTGGG - Intronic
1107996606 13:45867140-45867162 TATTCAATCCTGAATATTGTTGG - Intergenic
1108339509 13:49484160-49484182 TATCCCATTCTGAGAGTTTGTGG + Intronic
1111909872 13:94299302-94299324 TCCCCAATTCTCAAAGCTGTTGG - Intronic
1112719088 13:102222392-102222414 TATGTAATTTTGAAAGTTGAAGG + Intronic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1117194789 14:53329040-53329062 TAGACAATTCTCAAACTTGTAGG + Intergenic
1117479980 14:56132866-56132888 TGTTCACATCTGAAAGTTGTAGG - Intronic
1121187643 14:91990011-91990033 TAAGCAAGTCTGAAATTTGTAGG - Intronic
1123957538 15:25353759-25353781 CATCCAATTCTGAAAGACATAGG - Intronic
1127381307 15:58432928-58432950 TTTCTAATTCTCAAAGTTGTCGG - Intronic
1128486649 15:68097913-68097935 TTTCCACTTCTGACATTTGTGGG + Intronic
1128757782 15:70195201-70195223 TATCCATGTCTGAAACATGTTGG + Intergenic
1128922664 15:71626207-71626229 TCTCTAATTCTCAGAGTTGTTGG + Intronic
1129048777 15:72760650-72760672 AATCTAATTTTGAAAGCTGTTGG + Intronic
1135204265 16:20469480-20469502 TTTCCAATTCTCTAAATTGTTGG + Intronic
1135214731 16:20555486-20555508 TTTCCAATTCTCTAAATTGTTGG - Intronic
1137542132 16:49371631-49371653 AGTCAAATTCTGAAAGTTTTTGG - Intergenic
1137544682 16:49393475-49393497 TTTCCAATTTTTAAAGTTGAGGG - Intronic
1137966665 16:52941394-52941416 TTTCTAAATCTGTAAGTTGTAGG - Intergenic
1143901213 17:10176189-10176211 TATCCGATTAGGAAAGCTGTTGG - Intronic
1144090492 17:11851686-11851708 AATCCCATTCTCAATGTTGTCGG - Intronic
1144616162 17:16775636-16775658 TCTCCCATTCTGTAGGTTGTCGG + Intronic
1144896541 17:18540025-18540047 TCTCCCATTCTGTAGGTTGTCGG - Intergenic
1145135678 17:20404196-20404218 TCTCCCATTCTGTAGGTTGTCGG + Intergenic
1145855219 17:28149458-28149480 CATCTAATTCAGAAATTTGTAGG + Intronic
1146137536 17:30336097-30336119 TATCCAATTGTAGAAGTTGCTGG - Intergenic
1147762611 17:42809350-42809372 TCTCTATTTCTGAAGGTTGTGGG + Exonic
1150562656 17:66307338-66307360 TTTCTAGTTCTCAAAGTTGTGGG + Intronic
1153124688 18:1776621-1776643 TGTCCAATTCAGAAAGGTGAAGG + Intergenic
1155309728 18:24511848-24511870 TACCTAACTCAGAAAGTTGTTGG + Intergenic
1155642800 18:28039739-28039761 CCTCCAATTTTAAAAGTTGTAGG + Intronic
1156239988 18:35243824-35243846 TAACCCATTCTGAAAATTGCAGG + Intronic
1156594296 18:38529480-38529502 TAGTCAATTCTGAGAGTTGAAGG + Intergenic
1157263665 18:46197999-46198021 TTTCCATTTTTGAAAATTGTGGG + Intronic
1157761556 18:50268963-50268985 TATAGAATTCAGAAAATTGTTGG - Intronic
1159251752 18:65888152-65888174 TCTCCAATACTGAATATTGTAGG - Exonic
1159493610 18:69171102-69171124 TTTCCAATTCTGAAATTCCTGGG + Intergenic
1160470736 18:79130552-79130574 TATCAAATTTAGAAAGTTTTTGG - Intronic
1164136160 19:22418260-22418282 TATCAAATTATGAAACTTGAGGG - Intronic
1165578634 19:36843284-36843306 TACCCATTTCTGAAACTGGTTGG + Intronic
1168666788 19:58210403-58210425 TATGCATTTCTGAAGGTTGAGGG - Intronic
927310213 2:21622194-21622216 TAACCAATTCTTAAGCTTGTAGG + Intergenic
928227231 2:29461493-29461515 TTTACCATTCTGAAAATTGTGGG + Intronic
929359501 2:41068654-41068676 AATACATTTCTGAAAGATGTTGG + Intergenic
929375940 2:41287236-41287258 TATCCAAGTCTGGAAGTGGTGGG - Intergenic
929984614 2:46715544-46715566 TTTTCACTTTTGAAAGTTGTTGG + Intronic
930403737 2:50927216-50927238 TATCCAATTAAGAAGGTTTTAGG - Intronic
931600180 2:63995071-63995093 TAGCCAATTTCTAAAGTTGTGGG - Intronic
932689414 2:73899763-73899785 TATCCTATTCTGGACCTTGTGGG + Intronic
934019327 2:87928982-87929004 TCTCCCATTCTGTAGGTTGTCGG + Intergenic
935142280 2:100363999-100364021 TAGCCAATTTTCAAAGTTCTGGG + Intergenic
939472257 2:142637950-142637972 TGTCCATTTCTGAAAGTCCTAGG - Intergenic
941050356 2:160725708-160725730 TATCCAATACTGAAAGATGATGG + Intergenic
941491668 2:166149710-166149732 TATCAAATTCAGAACGTGGTGGG + Intergenic
944100054 2:196015195-196015217 TATCAAATTTTGTAATTTGTGGG + Intronic
945189387 2:207170633-207170655 TTTACCATTTTGAAAGTTGTAGG + Intergenic
946516495 2:220417219-220417241 TCTCCAATTCTGGAAGTGATCGG - Intergenic
946615167 2:221501157-221501179 TATCCAATTTTGCAAGCTGCAGG + Exonic
1170754612 20:19188857-19188879 TATCAAATTCTAAAATTTTTTGG - Intergenic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1174684220 20:52438149-52438171 AATCCCATTCCCAAAGTTGTTGG + Intergenic
1174768715 20:53277764-53277786 CATCCAATTCTCCAAGTTGCAGG - Intronic
1175595102 20:60224763-60224785 TATGCATTTCTCACAGTTGTGGG - Intergenic
1177005708 21:15669612-15669634 TATACACCTCTGAAAGGTGTGGG - Intergenic
1177370480 21:20197257-20197279 TAACCAATTCTTAAAGATGTAGG + Intergenic
1180654161 22:17405107-17405129 TATACATTTTTGAAAGTTTTAGG + Intronic
1182624031 22:31633122-31633144 TTTCCAGTTCTGGAAGTTGGTGG - Intronic
1182756594 22:32684904-32684926 TATCTAATTCTCAAGATTGTTGG + Intronic
1184572846 22:45337571-45337593 TATTCAGTTCTGAAAGCTGAGGG - Intronic
1185307643 22:50129885-50129907 TATCCAATTTTCATTGTTGTGGG + Intronic
949409071 3:3744146-3744168 TATCCAATTCTTAGAATAGTTGG - Intronic
950844545 3:16001966-16001988 TATCCAATTCAGCAAATTCTGGG - Intergenic
951190257 3:19760638-19760660 TAGCCAATTCCGAAAATAGTGGG - Intergenic
951699880 3:25485545-25485567 TTTCCAAGTCTGAAGGTAGTGGG - Intronic
952492202 3:33883465-33883487 TATCCAATTATGAAACAAGTGGG - Intergenic
956878300 3:73485610-73485632 GATCTCATTCAGAAAGTTGTTGG - Intronic
957403880 3:79752084-79752106 GATACAATTCTGACAGATGTAGG + Intronic
958212958 3:90514963-90514985 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958223004 3:90720309-90720331 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958223053 3:90721159-90721181 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958223131 3:90772490-90772512 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958223330 3:90775889-90775911 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958223729 3:90782685-90782707 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958223829 3:90784384-90784406 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958223928 3:90786083-90786105 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958223971 3:90786932-90786954 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958224072 3:90788631-90788653 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958224271 3:90792028-90792050 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958224374 3:90793727-90793749 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958224479 3:90795427-90795449 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958224587 3:90797126-90797148 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958224688 3:90798825-90798847 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958224790 3:90800524-90800546 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958224896 3:90802223-90802245 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958225093 3:90805621-90805643 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958225202 3:90807319-90807341 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958225300 3:90809018-90809040 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958225405 3:90810717-90810739 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958225507 3:90812416-90812438 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958225612 3:90814115-90814137 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958225705 3:90815817-90815839 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958225901 3:90819213-90819235 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958226100 3:90822610-90822632 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958226198 3:90824309-90824331 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958226298 3:90826008-90826030 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958226490 3:90829407-90829429 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958226801 3:90834506-90834528 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958226910 3:90836205-90836227 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958227014 3:90837904-90837926 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958227418 3:90844703-90844725 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958227523 3:90846400-90846422 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958227626 3:90848099-90848121 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958227725 3:90849796-90849818 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958227776 3:90850646-90850668 TATTCAAATCTGAGAGTTGAAGG - Intergenic
958227877 3:90852346-90852368 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958227976 3:90854045-90854067 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958228072 3:90855743-90855765 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958228178 3:90857442-90857464 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958228280 3:90859142-90859164 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958228376 3:90860841-90860863 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958228473 3:90862540-90862562 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958228664 3:90865939-90865961 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958228766 3:90867639-90867661 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958228871 3:90869338-90869360 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958228970 3:90871037-90871059 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958229067 3:90872736-90872758 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958229164 3:90874435-90874457 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958229367 3:90877834-90877856 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958229470 3:90879532-90879554 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958229670 3:90882930-90882952 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958229769 3:90884629-90884651 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958229870 3:90886329-90886351 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958229971 3:90888027-90888049 TATTCAACTCTGAAAGTTGAAGG - Intergenic
958230073 3:90889726-90889748 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958230172 3:90891425-90891447 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958230476 3:90896522-90896544 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958230579 3:90898222-90898244 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958230676 3:90899921-90899943 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958230781 3:90901619-90901641 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958230887 3:90903318-90903340 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958231089 3:90906716-90906738 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958231290 3:90910115-90910137 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958231386 3:90911814-90911836 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958231489 3:90913513-90913535 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958231593 3:90915212-90915234 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958231693 3:90916912-90916934 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958231792 3:90918611-90918633 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958231995 3:90922010-90922032 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958232103 3:90923710-90923732 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958232201 3:90925408-90925430 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958232304 3:90927107-90927129 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958232408 3:90928806-90928828 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958232608 3:90932205-90932227 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958232708 3:90933904-90933926 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958232813 3:90935604-90935626 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958232918 3:90937301-90937323 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958233019 3:90939000-90939022 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958233119 3:90940698-90940720 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958233225 3:90942397-90942419 TATTCAAATCTGAGAGTTGAAGG - Intergenic
958233320 3:90944096-90944118 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958233425 3:90945795-90945817 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958233524 3:90947495-90947517 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958233632 3:90949194-90949216 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958233946 3:90954292-90954314 TATTCAATTCTGAGAGTTGAAGG - Intergenic
958234050 3:90955990-90956012 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958234151 3:90957688-90957710 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958234253 3:90959388-90959410 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958234351 3:90961087-90961109 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958234648 3:90966184-90966206 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958234752 3:90967883-90967905 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958234846 3:90969581-90969603 TATTCAAATCTGAGAGTTGAAGG - Intergenic
958235045 3:90972978-90973000 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958235146 3:90974679-90974701 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958235240 3:90976377-90976399 TATTCAACTCTGAAAGTTGAAGG - Intergenic
958235530 3:90981475-90981497 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958235631 3:90983172-90983194 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958235940 3:90988270-90988292 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958236046 3:90989969-90989991 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958236143 3:90991667-90991689 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958236349 3:90995066-90995088 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958236649 3:91000161-91000183 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958236759 3:91001861-91001883 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958237162 3:91008657-91008679 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958237361 3:91012056-91012078 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958237569 3:91015453-91015475 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958237667 3:91017152-91017174 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958237766 3:91018851-91018873 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958237867 3:91020555-91020577 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958237970 3:91022253-91022275 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958238068 3:91023952-91023974 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958238167 3:91025650-91025672 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958238359 3:91029044-91029066 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958238465 3:91030743-91030765 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958238568 3:91032442-91032464 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958238664 3:91034142-91034164 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958238767 3:91035841-91035863 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958238863 3:91037539-91037561 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958238965 3:91039238-91039260 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958239062 3:91040938-91040960 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958239175 3:91042637-91042659 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958239483 3:91047733-91047755 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958239581 3:91049432-91049454 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958239684 3:91051131-91051153 TATTCAATTCTGAGAGTTGAAGG - Intergenic
958239888 3:91054528-91054550 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958240788 3:91069816-91069838 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958240888 3:91071515-91071537 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958241098 3:91074914-91074936 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958241211 3:91076615-91076637 TATTCAAATCTGAGAGTTGAAGG - Intergenic
958241309 3:91078313-91078335 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958241511 3:91081713-91081735 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958241715 3:91085112-91085134 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958241817 3:91086812-91086834 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958241914 3:91088513-91088535 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958241965 3:91089363-91089385 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958242169 3:91092762-91092784 TATTCAATTCTGAGAGTTGAAGG - Intergenic
958242271 3:91094461-91094483 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958242373 3:91096162-91096184 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958242475 3:91097860-91097882 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958242578 3:91099559-91099581 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958242684 3:91101258-91101280 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958242781 3:91102957-91102979 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958242878 3:91104657-91104679 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958243076 3:91108055-91108077 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958243173 3:91109753-91109775 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958243495 3:91114848-91114870 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958243592 3:91116547-91116569 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958243688 3:91118247-91118269 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958243792 3:91119946-91119968 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958243891 3:91121645-91121667 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958244293 3:91128442-91128464 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958244398 3:91130141-91130163 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958244594 3:91133541-91133563 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958244704 3:91135240-91135262 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958244801 3:91136939-91136961 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958244909 3:91138639-91138661 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958245014 3:91140339-91140361 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958245213 3:91143737-91143759 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958245411 3:91147136-91147158 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958245509 3:91148835-91148857 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958245610 3:91150533-91150555 CATTCAATTCTGAGAGTTGAAGG - Intergenic
958245709 3:91152232-91152254 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958245808 3:91153932-91153954 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958245910 3:91155630-91155652 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958246006 3:91157331-91157353 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958246119 3:91159030-91159052 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958246218 3:91160729-91160751 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958246720 3:91169223-91169245 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958246822 3:91170923-91170945 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958247032 3:91174323-91174345 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958247734 3:91186216-91186238 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958247941 3:91189614-91189636 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958248148 3:91193012-91193034 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958248248 3:91194711-91194733 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958248298 3:91195561-91195583 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958248354 3:91196410-91196432 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958248562 3:91199809-91199831 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958248860 3:91204903-91204925 TATTCAACTCTGAGAGTTGAGGG - Intergenic
958249063 3:91208301-91208323 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958249268 3:91211699-91211721 TATTCAATTCTGAGAGTTGAAGG - Intergenic
958249371 3:91213400-91213422 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958249470 3:91215099-91215121 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958249772 3:91220197-91220219 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958249983 3:91223593-91223615 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958250087 3:91225291-91225313 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958250288 3:91228690-91228712 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958250490 3:91232088-91232110 TATTCAACTCTGAGAGTTGAAGG - Intergenic
958251456 3:91247983-91248005 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958251558 3:91249682-91249704 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958251720 3:91261266-91261288 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958251816 3:91262965-91262987 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958251901 3:91264492-91264514 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958252034 3:91278430-91278452 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958252128 3:91280129-91280151 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958252225 3:91281832-91281854 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958252272 3:91283166-91283188 TATTCAACTCTGAGAGTTGAAGG + Intergenic
958252386 3:91285204-91285226 TATTCAACTCTGAGAGTTGAAGG + Intergenic
960187978 3:114667517-114667539 TACCCAATTCTCTAACTTGTTGG - Intronic
961855135 3:129862788-129862810 TAGACATTTCTGAAAGTTTTTGG - Intronic
963124490 3:141802649-141802671 TATCCAGCTCTGAAAGTGGAGGG - Intronic
964614736 3:158650590-158650612 AATTAAAATCTGAAAGTTGTGGG + Intronic
966671842 3:182536110-182536132 TCTCCCATTCTGTAGGTTGTCGG + Intergenic
967095743 3:186175800-186175822 TCTCCCATTCTGTAAGCTGTCGG - Intronic
969519813 4:7669526-7669548 TAGCCACTTCTATAAGTTGTTGG - Intronic
970640758 4:18063466-18063488 TATTAATTTCAGAAAGTTGTTGG + Intergenic
970648618 4:18152386-18152408 TATCCATTCCAGAAACTTGTTGG - Intergenic
970936790 4:21581095-21581117 TATCTATTTCTGAAAGGTTTAGG + Intronic
970936792 4:21581133-21581155 TTTCCATTTCTGAAAGGTTTAGG + Intronic
971226429 4:24757036-24757058 TATCAAATTTGGAAAGTTTTTGG + Intergenic
971555804 4:28012323-28012345 TAGCCAATTCTGTAACTTCTAGG + Intergenic
971718954 4:30219678-30219700 AATCAAATTCTGAAAGTTCAAGG - Intergenic
971856128 4:32045765-32045787 TCTCCCACTCTGAAAGTTGTTGG - Intergenic
972134655 4:35877034-35877056 TAGGCAATTCTGAAAGGTGCTGG - Intergenic
972202771 4:36735156-36735178 TATTAAATTTTGAATGTTGTAGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972971980 4:44587961-44587983 TCTCCAAATCTGTAGGTTGTAGG - Intergenic
973213378 4:47641016-47641038 TATTCAATTCCTAAAGATGTTGG + Intronic
974248566 4:59355704-59355726 TCTCCCATTCTGTAAGCTGTTGG + Intergenic
974355589 4:60808676-60808698 TAGCCAACTCTGAAAGATGCTGG + Intergenic
975184871 4:71389640-71389662 TGTCCAAGTCTGAAGGTTCTTGG + Intronic
975483702 4:74911126-74911148 TCTCCCATTCTGTAAGTTGCGGG + Intergenic
975759104 4:77600391-77600413 TATGCAATTTTGAAAGTTTTTGG - Intronic
975892610 4:79047434-79047456 TATCCAACTCTGAATACTGTTGG + Intergenic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
976675364 4:87696876-87696898 TAAACAATTTTGAAAGTTTTAGG - Intergenic
976934666 4:90615006-90615028 TTTCCCATTCTGAAAATTGTAGG + Intronic
979905654 4:126287388-126287410 AATTCAATCCTGAAATTTGTAGG + Intergenic
982997106 4:162363198-162363220 TATACATTACTGAAAATTGTTGG - Intergenic
983819654 4:172176965-172176987 TATCTCAATCTGAAAGTTCTGGG + Intronic
983986557 4:174066830-174066852 TATCCCATTTTGAGAGTTTTGGG + Intergenic
984303266 4:177951988-177952010 AATTCAATTCTGAATTTTGTAGG - Intronic
987091943 5:14515969-14515991 TATAAAATTCTGACAGTTGTAGG + Intronic
988019098 5:25599986-25600008 AATCGGATCCTGAAAGTTGTTGG - Intergenic
988094163 5:26581378-26581400 TCTCCAATTCTGTAAGTTGTTGG + Intergenic
988894923 5:35662360-35662382 TCTCCCATTCTGTAGGTTGTTGG + Intronic
990643679 5:57818327-57818349 TAACCATTTCTGGTAGTTGTTGG - Intergenic
991474901 5:67009087-67009109 GACCCAATTTTGAAAGCTGTAGG + Intronic
992851252 5:80811550-80811572 TATCCAAATCTGAAATTATTTGG + Intronic
993423541 5:87733178-87733200 TTTCCAATTCTGAAAATTAGTGG + Intergenic
993604410 5:89970583-89970605 TTACCAATTCTGTAAGTCGTGGG - Intergenic
994829147 5:104755525-104755547 TATCCAATTCTGTAGGGTCTGGG + Intergenic
995389165 5:111620720-111620742 TATCCAGTCCTGAATGTGGTAGG - Intergenic
997111437 5:131079066-131079088 TATCCAATTCTGGGACTTGAAGG + Intergenic
997401329 5:133605374-133605396 CATCCAATTCAGAAAGAAGTGGG + Intronic
997995324 5:138581205-138581227 TATTTAATTCTTAAAGATGTAGG + Intergenic
999553976 5:152720935-152720957 TTTCCCATCCTGAAAGTTTTAGG - Intergenic
999784537 5:154879456-154879478 TTTCCCATTCTGGAAGTTTTAGG - Intergenic
1000732947 5:164859058-164859080 TATCTAAAACTGAAAGTTGTTGG + Intergenic
1000809270 5:165840444-165840466 TCTCCCATTCTGTAGGTTGTTGG + Intergenic
1004140155 6:13010688-13010710 GATCCCCTTCTGAAACTTGTTGG - Intronic
1005075739 6:21904784-21904806 TTGTTAATTCTGAAAGTTGTTGG + Intergenic
1005677678 6:28172250-28172272 TATCCAAGTCTCAAAAATGTTGG - Intergenic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1010468857 6:76201543-76201565 TATCCCATTCTGTAGGTTGCTGG - Intergenic
1012053982 6:94381699-94381721 TTTGCAATTTTGAAATTTGTAGG + Intergenic
1013414763 6:109914905-109914927 TATACCATTCTGAAAATTCTAGG + Intergenic
1013629297 6:111970135-111970157 TATCAAATTTAGATAGTTGTTGG + Intergenic
1014218349 6:118774907-118774929 TATCCAATCCTGGGATTTGTTGG + Intergenic
1015027297 6:128551037-128551059 TATAGAATTCTCAAAGTTTTGGG + Intergenic
1015645086 6:135378415-135378437 TATCAAATACTAAAAATTGTAGG - Intronic
1015857032 6:137635814-137635836 TATAAAATTCTGCAAGTTTTGGG + Intergenic
1016095687 6:140033655-140033677 TTTCCAACTCTGAAAGATGATGG + Intergenic
1017438662 6:154442210-154442232 TATGTAATTCTGTAAATTGTGGG + Exonic
1017643754 6:156519169-156519191 TTTCTAATTCTGATAGATGTTGG - Intergenic
1017986054 6:159444100-159444122 TATCCAATTCTAAAACTTTGAGG - Intergenic
1018120591 6:160631366-160631388 TTTCCAATTCTGACAGTTTCCGG + Intronic
1018155953 6:160985236-160985258 TCTCCAAGTCTGAAAGGAGTCGG + Intergenic
1020959089 7:14779626-14779648 TATTCAGTTCTGGAATTTGTGGG - Intronic
1021311071 7:19097413-19097435 TATGAAATTCTCAAAGTTTTAGG - Intronic
1023118137 7:36882760-36882782 GAACCAATTCTGGAAGATGTAGG - Intronic
1026413116 7:70147488-70147510 TTTACAAGTCTGGAAGTTGTAGG - Intronic
1027766992 7:82356507-82356529 TATCTAATTCTGAAAGTATAAGG - Intronic
1028287368 7:89019554-89019576 TATCCAATTCTGAAAGTTGTGGG + Intronic
1029583415 7:101453589-101453611 TGTCCCCTTCTGAAAGTTTTAGG + Intronic
1029936755 7:104432979-104433001 AAACCAATTCTGAAATTTTTTGG + Intronic
1030652715 7:112132707-112132729 TATCCAATACAGAAAGTAGGAGG + Intronic
1031268659 7:119615905-119615927 TATCCAATAATGAAATTTCTAGG + Intergenic
1032572747 7:133017998-133018020 TAACCAGTTCTGAATGTAGTAGG - Intronic
1035935208 8:3829399-3829421 TATCTCATTCTGACTGTTGTAGG - Intronic
1036402939 8:8426469-8426491 CATCCAATTCTAAAAGCAGTTGG + Intergenic
1037490948 8:19396727-19396749 CATCCAATTCTGAAATTTTAAGG + Intergenic
1041248316 8:55910079-55910101 TCTCCCATTCTGCAGGTTGTCGG + Intronic
1041443110 8:57919657-57919679 TTTACAACTCTGCAAGTTGTAGG - Intergenic
1043588825 8:81802977-81802999 TTTCTGATTCTGAAAGTTGTAGG - Intronic
1043922240 8:85996775-85996797 TTTACAGTTCTGTAAGTTGTGGG - Intronic
1044249832 8:89993021-89993043 TGTCCATTTCTGAAAGGTGTGGG + Intronic
1046663231 8:116971632-116971654 AATCAAATTCAGAAAGATGTTGG + Intronic
1047057063 8:121177086-121177108 AATCCACTTCTGAAAGTGGTTGG - Intergenic
1047834693 8:128675713-128675735 TCTCCCATTCTGTAGGTTGTTGG + Intergenic
1047937014 8:129791872-129791894 TGTCCAATACTAAAAGTCGTGGG + Intergenic
1050055110 9:1644384-1644406 TATCCACTTCTTCTAGTTGTTGG + Intergenic
1050649879 9:7764589-7764611 TTTACAATTCTGAAAATTCTGGG + Intergenic
1051460765 9:17311836-17311858 AAATCAATTCTGAAATTTGTAGG + Intronic
1051971711 9:22895949-22895971 TACACAATTCTGATAGTTTTGGG - Intergenic
1052694514 9:31859056-31859078 TCTCCCATTCTGTAGGTTGTTGG - Intergenic
1053776759 9:41551378-41551400 TTTTCAATTCTGTAAGTTTTTGG + Intergenic
1054364970 9:64327107-64327129 TTTTCAATTCTGTAAGTTTTTGG - Intergenic
1055162314 9:73145345-73145367 TAACCAATTCTGCATGTTCTTGG + Intergenic
1055870528 9:80873118-80873140 TTTCCAATTTTAAAAATTGTGGG - Intergenic
1057561924 9:96134716-96134738 TATTCAATTCTGAAACATTTGGG - Intergenic
1060454399 9:123777931-123777953 TATCAGAATCTGCAAGTTGTAGG - Intronic
1061474071 9:130851501-130851523 CATTCATTTCTGAAAGTTCTCGG + Intronic
1185917742 X:4054669-4054691 TCTCCCATTCTGTAGGTTGTCGG + Intergenic
1186365864 X:8892752-8892774 CACCCAAATCTAAAAGTTGTGGG + Intergenic
1187989901 X:24859029-24859051 TATCCAATGTGGAAACTTGTGGG - Intronic
1188993937 X:36859184-36859206 TATCCAAATGTAAAGGTTGTGGG + Intergenic
1189509370 X:41646554-41646576 TAGCCAATTTTTAAAGTTCTGGG - Intronic
1189972497 X:46432674-46432696 TATGCAAATCTGAAATCTGTAGG - Intergenic
1192013600 X:67302885-67302907 TCTCCCATTTTGTAAGTTGTTGG - Intergenic
1193076421 X:77360516-77360538 AATCCAATGCTAAAAGTAGTTGG + Intergenic
1193491643 X:82157439-82157461 TCTCCCATTCTGGAGGTTGTCGG + Intergenic
1193615165 X:83678440-83678462 TTTACTATTCTGAAAATTGTAGG - Intergenic
1194576832 X:95623633-95623655 TATTTAGTTCTGAAAGATGTTGG + Intergenic
1195994799 X:110721159-110721181 TATCCCAGTCTTAAAGCTGTAGG - Intronic
1196564705 X:117191147-117191169 TATCAAATTCTCAAAGATGAAGG + Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1198499988 X:137234488-137234510 TTTCCAATTTTGACAATTGTTGG + Intergenic
1199125200 X:144110157-144110179 TCTCCCATTCTGTAGGTTGTCGG - Intergenic
1199208309 X:145175148-145175170 TACCCAATTCGGAGAGTTTTTGG - Intergenic
1199424696 X:147687392-147687414 TCTCCCATTCTGTAAGTTGTTGG - Intergenic
1199969941 X:152852304-152852326 TAGGCAAGTCTGAAATTTGTAGG + Intronic