ID: 1028290370

View in Genome Browser
Species Human (GRCh38)
Location 7:89057710-89057732
Sequence GAAGCAGGCCACTGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028290364_1028290370 0 Left 1028290364 7:89057687-89057709 CCAGTGGCAAATGGCCAATGAAG 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1028290370 7:89057710-89057732 GAAGCAGGCCACTGTGGAGTGGG No data
1028290363_1028290370 1 Left 1028290363 7:89057686-89057708 CCCAGTGGCAAATGGCCAATGAA 0: 1
1: 0
2: 1
3: 12
4: 162
Right 1028290370 7:89057710-89057732 GAAGCAGGCCACTGTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028290370 Original CRISPR GAAGCAGGCCACTGTGGAGT GGG Intronic
No off target data available for this crispr