ID: 1028291383

View in Genome Browser
Species Human (GRCh38)
Location 7:89069291-89069313
Sequence GGCAAGGCCGTCCCCACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028291375_1028291383 27 Left 1028291375 7:89069241-89069263 CCTAGAGAGCTTCAGTTAAATGG 0: 1
1: 0
2: 3
3: 11
4: 203
Right 1028291383 7:89069291-89069313 GGCAAGGCCGTCCCCACAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028291383 Original CRISPR GGCAAGGCCGTCCCCACAGA AGG Intronic
900157341 1:1208578-1208600 GGCAGGGCCTTCGGCACAGATGG + Intergenic
900165074 1:1241286-1241308 GGGCAGGCCGTGCCCACAGAAGG + Intergenic
900429050 1:2593388-2593410 GGCAGGGCAGTCCCCACCGAGGG + Intronic
900533206 1:3164879-3164901 GGGAAGGCCGTCGCCACCGTGGG + Intronic
901504960 1:9678970-9678992 GCCAAGGCCCTTCCCACAAAAGG - Intronic
902763985 1:18602868-18602890 GGCAAAGCAGTCCCTACAAATGG + Intergenic
903793135 1:25907844-25907866 GGGGAGGCCGACCCCACACAAGG - Intergenic
905231532 1:36517551-36517573 GGCCATGGCGTCCCCACAGCTGG + Intergenic
905572264 1:39015094-39015116 GGCAAGGCCCTGCCCTCAGCAGG - Intergenic
906148865 1:43576192-43576214 TTCCAGGCCATCCCCACAGAAGG + Intronic
907981149 1:59482304-59482326 GGCAAGCCCGAGCCCACAGGAGG - Intronic
909469582 1:76012113-76012135 CCTAAGGCCTTCCCCACAGAGGG + Intergenic
911506662 1:98761472-98761494 TGCAAGCCCCTCCCGACAGATGG + Intergenic
915889195 1:159755761-159755783 GGATAGGCTGTCCCCACACAGGG - Intergenic
916787005 1:168093712-168093734 ATCAAGGCCTTGCCCACAGAGGG + Intronic
917132340 1:171755565-171755587 GCCTGGGCCGGCCCCACAGATGG + Intergenic
917354020 1:174107218-174107240 GCCAAGCTTGTCCCCACAGAAGG + Intergenic
919842521 1:201619621-201619643 GCCAAGGACAACCCCACAGAAGG - Intergenic
919851065 1:201673240-201673262 GGGCAGGCAGGCCCCACAGATGG + Intronic
921312228 1:213855791-213855813 TGCAAGGCAGACCACACAGAAGG - Intergenic
922698251 1:227742777-227742799 GGCAAGCCAGTACCCACAGGAGG - Intronic
922802060 1:228368940-228368962 GGGAAGCCAGTTCCCACAGATGG + Intronic
1067091467 10:43267675-43267697 GGCCAGGACTTGCCCACAGAAGG - Intergenic
1069564318 10:69452940-69452962 GGCAAGGCCCCACCCACAAAGGG - Intronic
1069701779 10:70432103-70432125 GGCAAGGCCTTCACCACTGCTGG + Intergenic
1070144491 10:73763962-73763984 GGCAAGGCTGCCCCCAGAGGAGG + Exonic
1076364927 10:129915638-129915660 GGGAAAGCTGTGCCCACAGATGG + Intronic
1076850642 10:133090880-133090902 GGCCAGGCCGTCCTCTCAAAAGG + Intronic
1077174298 11:1181642-1181664 GGCCAGGCCCTCCCCACTGCAGG - Intronic
1078461919 11:11520825-11520847 GGCAAGGCAGTCCCCTCAGCAGG + Intronic
1082050428 11:47766837-47766859 GGCAAGCCCTGCACCACAGATGG + Intronic
1083048787 11:59758541-59758563 GGCAACAGCGTCCACACAGAAGG + Intronic
1084068348 11:66718406-66718428 GGCACAGTCGTCCCCACAGGGGG + Intronic
1088170991 11:106996415-106996437 GGCAAGGCCTTCCCTACAGCTGG + Intronic
1088735453 11:112724533-112724555 TGCCAGGCCTACCCCACAGAAGG - Intergenic
1091890554 12:4050522-4050544 AGCAAGGCAGTCTCCACAGTGGG - Intergenic
1104035176 12:125092765-125092787 GCCCAGGCAGCCCCCACAGAGGG - Intronic
1104855770 12:131901930-131901952 AGCAAGGTCGTGCCCTCAGAAGG + Intronic
1105706324 13:22969650-22969672 GGGGAGGTCATCCCCACAGATGG + Intergenic
1106605605 13:31225730-31225752 GGGAAGACCCTCCCCACAGAGGG - Intronic
1108502875 13:51084361-51084383 GGCTTGGCCGGCCACACAGAGGG + Intergenic
1111879873 13:93942911-93942933 AGCAAGGCCATCCCAACTGAGGG - Intronic
1113957174 13:114105145-114105167 GGCCAAGCCGTCACCTCAGAAGG + Intronic
1117755528 14:58970616-58970638 GGCAGCTCCTTCCCCACAGAAGG - Intergenic
1119687451 14:76644020-76644042 GGCAAGGCCTCACCCTCAGAGGG + Intergenic
1120715869 14:87840169-87840191 GTCAAGGCAGTACCCACTGAGGG - Intronic
1120745441 14:88147248-88147270 GGGAAGGCCCTCCCCACTGATGG + Intergenic
1121314285 14:92951917-92951939 GGCCAGGCCATCCCAGCAGAGGG + Intronic
1121605651 14:95238062-95238084 GGCAAGCCCTGCCCCACTGACGG + Intronic
1122687194 14:103514950-103514972 GGCAGGGCAGTCCTCCCAGAGGG + Intergenic
1127151202 15:56077313-56077335 GGCAAGGGCTTCCCCTCAGATGG + Intergenic
1128979564 15:72176332-72176354 GGCAGGGCCTTCCCCACAGCTGG + Intronic
1132299868 15:100768780-100768802 GGGAAGCCCCTGCCCACAGAAGG + Intergenic
1132580102 16:680742-680764 GGCCCGGCCGGCCCCACCGAGGG + Intronic
1135856652 16:26017837-26017859 GGAAAGGCAGACCCCACAAATGG + Intronic
1136186191 16:28590304-28590326 GGCAGGGATGGCCCCACAGAGGG - Exonic
1136318008 16:29465511-29465533 GGCAGGGATGGCCCCACAGAGGG + Exonic
1136432583 16:30204860-30204882 GGCAGGGATGGCCCCACAGAGGG + Exonic
1136548033 16:30966225-30966247 GGCAAGACCCTCCCGACAGCAGG + Exonic
1138721633 16:59089041-59089063 GGAAAGGCCAGCCTCACAGAAGG + Intergenic
1141557433 16:84845424-84845446 GCCAAGACCGTCCCTAGAGATGG + Intronic
1142182100 16:88676309-88676331 GGATTGGCCGTCCCCAGAGAGGG - Intergenic
1142279300 16:89139354-89139376 GGGAAAGCAGTCCCCACAGCTGG - Intronic
1148355016 17:46969755-46969777 GGCCTGGGAGTCCCCACAGAGGG - Intronic
1150885468 17:69080767-69080789 GGCAAAGCAGGCCACACAGAGGG + Intronic
1152209630 17:78996177-78996199 GGCCAGGCCCTCCCCACACCCGG - Intronic
1152682055 17:81673539-81673561 GGCAAGGCCCTGCCCTCAGCAGG - Exonic
1156471230 18:37378320-37378342 GGCTGGGCCACCCCCACAGAAGG + Intronic
1157301608 18:46483670-46483692 GGCAAGGTGGCCCACACAGAGGG + Exonic
1163702163 19:18791343-18791365 GGCACGGCCGGCCCCAGGGACGG + Intergenic
1163813314 19:19448134-19448156 AGCCAGGCCCTTCCCACAGAAGG + Intronic
1165167440 19:33866778-33866800 GGCATGGCCGGCTCCACAGATGG + Intergenic
1167209871 19:48127462-48127484 AGCATGGCCGCCCTCACAGATGG - Intronic
925244392 2:2367427-2367449 AGCCAGGCCCGCCCCACAGATGG - Intergenic
926286479 2:11492829-11492851 TGCCAGGCAGTACCCACAGAGGG + Intergenic
930030689 2:47056493-47056515 GGCAAGGCCCTCCCTGCAAAGGG + Intronic
932400654 2:71478941-71478963 GGCGGGGCCGACCCCACAGGAGG + Intronic
933723112 2:85410542-85410564 TGCCAGGCCGTCTCCTCAGAGGG + Exonic
935735016 2:106099619-106099641 GCAAAGGCCCTCCCCAAAGAGGG + Intronic
935841995 2:107123550-107123572 AGCAAGGCAGGTCCCACAGAAGG - Intergenic
936345132 2:111669930-111669952 GGAAAGGCTGACCTCACAGAGGG - Intergenic
942565694 2:177263939-177263961 CGCAAAGCCGCGCCCACAGACGG + Intronic
947124553 2:226853760-226853782 AGCAAGGCCATTCCCACAGATGG - Intronic
947965936 2:234281624-234281646 GGCAAGGCAGCTCCCTCAGAGGG - Intergenic
948514443 2:238494995-238495017 GGCAAGCCCTTCCCCACACTGGG + Intergenic
948903994 2:240969190-240969212 TGCAAGGCCGTCCCTCCTGATGG - Intronic
949043012 2:241858066-241858088 GCCAAGGCCTCCCCCACGGATGG + Intronic
1170142318 20:13137269-13137291 GGCAACAACTTCCCCACAGATGG - Intronic
1172083309 20:32358914-32358936 GGCAAGGCCCTGCCCACCGCGGG + Intronic
1175239204 20:57534130-57534152 GGGAAGAGCATCCCCACAGAAGG - Intergenic
1175960858 20:62635673-62635695 GGCGAGGCCGTCTCCAGAGCTGG + Intergenic
1176101583 20:63366875-63366897 GTCAAGGACATCCCCACAGGAGG - Intronic
1179088141 21:38238452-38238474 GGCCTGGCGGTCTCCACAGATGG + Intronic
1181691950 22:24567919-24567941 GTCAAGGCCCTCCCCACCGCTGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
952509993 3:34043359-34043381 GGCAAGGCAGTTCCTACAGGGGG + Intergenic
956717172 3:72088608-72088630 GGCAAGGCCCTGCCCTCAGCAGG - Intergenic
960208373 3:114930620-114930642 GGCAAGGGCGACCTCACAGGCGG + Intronic
961066369 3:123880610-123880632 GGCAAGGAAGTACCAACAGAGGG + Intronic
962684171 3:137830553-137830575 GGCAGTGCCGTCTCCTCAGAAGG + Intergenic
963956985 3:151264880-151264902 GGCAAGGCAGTGGCCACAGGAGG - Intronic
965736677 3:171827854-171827876 GGCAAAGCCTTGGCCACAGAAGG + Intergenic
966986479 3:185184599-185184621 AGCAAGGCAGTCCCTAAAGAAGG + Intergenic
967203344 3:187095234-187095256 GGCAACTGCATCCCCACAGAAGG + Intergenic
968688488 4:1977136-1977158 GGGCAGGCTGTCCCCAGAGATGG + Intronic
970581883 4:17481118-17481140 CGCAAGGACCTCCCCACAGCTGG + Intronic
974880663 4:67753109-67753131 GCACAGGCCCTCCCCACAGAGGG - Intronic
978352882 4:107838899-107838921 GGCAAGGCAGTGGCTACAGAAGG - Intronic
983282683 4:165701011-165701033 GGCAGGGCTGGTCCCACAGATGG - Intergenic
985695658 5:1338742-1338764 AGCAAGTGCCTCCCCACAGAGGG + Intronic
985902863 5:2810512-2810534 GGCAAGGATGTCACCACTGAGGG - Intergenic
987076478 5:14386944-14386966 GCCACGGCTGTCCCCACAGCAGG - Intronic
990775266 5:59299372-59299394 ATCAAGTCCGTTCCCACAGAGGG - Intronic
991960481 5:72039239-72039261 GGGAAGAGCATCCCCACAGAAGG - Intergenic
999140106 5:149355369-149355391 GGGAAGGCTGGCCCAACAGAGGG - Intergenic
999283323 5:150379292-150379314 GCCACGGCCTTCCCCACAGATGG - Exonic
1003974543 6:11329901-11329923 GGCAAGGCCCTCCCCAGTGCAGG - Intronic
1004901217 6:20196012-20196034 GATGAGGCCCTCCCCACAGAGGG + Intronic
1005032700 6:21526165-21526187 GGCTAGACTGTCCCCACATATGG - Intergenic
1006835248 6:36994835-36994857 GGCAAGGCTGACCCCACAGTGGG - Intergenic
1017070091 6:150568338-150568360 TGCAAGTCCCTCCCCACACAAGG - Intergenic
1019701263 7:2475970-2475992 GGCCAGGCCGCCCGCACAGAAGG + Exonic
1023017590 7:35982869-35982891 GCCGAGGCCGTTGCCACAGAAGG + Intergenic
1023237544 7:38106319-38106341 GACAAGGCTGCTCCCACAGAGGG + Intergenic
1026773650 7:73217799-73217821 GGCAAGGCCGTTCACACCCAGGG + Intergenic
1027014509 7:74771193-74771215 GGCAAGGCCGTTCACACCCAGGG + Intergenic
1027073524 7:75174764-75174786 GGCAAGGCCGTTCACACCCAGGG - Intergenic
1028291383 7:89069291-89069313 GGCAAGGCCGTCCCCACAGAAGG + Intronic
1032516312 7:132508729-132508751 GGCACAGTCGTCCCCTCAGAGGG + Exonic
1034354912 7:150444252-150444274 GTCAAGGCCGACTCCACACATGG - Intergenic
1037834198 8:22206778-22206800 GGAAGGGCCTTCCCCACAGGAGG + Intronic
1039968342 8:42299806-42299828 GGCCAGGCAATCCCCACAGAGGG - Intronic
1041154682 8:54973130-54973152 GGCAAAGCTGTGCACACAGAGGG - Intergenic
1043086155 8:75835972-75835994 GGCAAGGAGGATCCCACAGAGGG + Intergenic
1047764532 8:127979769-127979791 GCCAAGGCAGTTCCCAGAGAGGG + Intergenic
1049760634 8:144330658-144330680 GGCCAGGCCGGCCGGACAGACGG - Exonic
1053478056 9:38396220-38396242 GGCAAGACCATCCCCATGGATGG + Exonic
1056750618 9:89348364-89348386 GGAAGGGAGGTCCCCACAGATGG + Intronic
1057172223 9:92969745-92969767 GGCAGGGCTGGTCCCACAGATGG - Intronic
1062275517 9:135728591-135728613 GCCAAGGCCATGCCCACGGAGGG + Intronic
1062559891 9:137136803-137136825 GGCAAGGGGATCTCCACAGAGGG + Intergenic
1190385235 X:49878435-49878457 GACAAGGCCATCCCTACAGCTGG - Intergenic
1196457885 X:115902867-115902889 GCCAAGGCCATCCAGACAGAAGG - Intergenic
1197252632 X:124231506-124231528 GGGAAAGCCCTCCCCACTGATGG + Intronic
1198378527 X:136062670-136062692 GGCAAGGAGGTCCAGACAGATGG + Intergenic
1202625241 Y:56850529-56850551 GTCTAGGCTGTCCCCACAGGGGG + Intergenic