ID: 1028295526

View in Genome Browser
Species Human (GRCh38)
Location 7:89125120-89125142
Sequence TTAATCTCTTCAGCTTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 6, 3: 20, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028295526 Original CRISPR TTAATCTCTTCAGCTTAAGG GGG Intronic
901460813 1:9390474-9390496 TTAATCTCTTCAGGATTGGGAGG - Intergenic
901486202 1:9564051-9564073 TTAATCTCTTTTTCTTATGGAGG - Intronic
902073004 1:13757700-13757722 TTAGTCTTTTCAGCTTTAGGTGG + Intronic
904387595 1:30154307-30154329 TTAATCTCTTCAGGATTGGGAGG + Intergenic
906968637 1:50486162-50486184 TTAATATTTTCTACTTAAGGTGG + Intronic
909127703 1:71695537-71695559 TTAATCACTTTAACTTAAGAGGG - Intronic
909810677 1:79929046-79929068 TTTATCTCTTCAGAAAAAGGTGG - Intergenic
909939765 1:81597697-81597719 ATAATATTTTCAGCTTAAGATGG - Intronic
910902115 1:92132345-92132367 TTAATCTCATCAGCTCATGAGGG - Intronic
912883524 1:113444344-113444366 GGAATCACTTCAGCTGAAGGGGG - Intronic
915435001 1:155897605-155897627 GTAATCTCTTCAAATGAAGGGGG + Intergenic
915892936 1:159788297-159788319 TTAATCTCTTCAGGATTGGGGGG + Intergenic
916335713 1:163669072-163669094 TGAAACTCTTCATCTTATGGTGG - Intergenic
917352280 1:174090660-174090682 TTCCTCTCTGCAGCTTAATGTGG + Intergenic
917556068 1:176089956-176089978 TTAATCTCTTCAGGATTGGGAGG - Intronic
917562371 1:176172695-176172717 TTCATTGCTTCAGCTTAAGACGG - Intronic
917861772 1:179152751-179152773 TTATTCTCTGCAACTTCAGGTGG - Intronic
918968471 1:191381346-191381368 TTAATCTCTTCAGGATTGGGAGG - Intergenic
921504275 1:215948002-215948024 TGAATCTCTTTAGCTAAAGGTGG - Intronic
921990872 1:221365236-221365258 TTAATCTCTTCAGGATTGGGAGG + Intergenic
923360199 1:233203700-233203722 TTGATCTCTTCTGCACAAGGAGG + Intronic
1063004907 10:1961097-1961119 TTTGTCTCTTCAGATTATGGAGG + Intergenic
1063095857 10:2908252-2908274 ATAATCTCTCCATCTCAAGGTGG - Intergenic
1063995704 10:11616645-11616667 TTAAGCTTTTGAGCTTAGGGTGG + Intergenic
1064333617 10:14417560-14417582 TTAATCTCTTCAGGATTGGGAGG + Intronic
1064545987 10:16450328-16450350 TTAATCTCCTCAGACAAAGGTGG + Intronic
1064927832 10:20589139-20589161 TTTATGTGTTCAGCTTAATGGGG - Intergenic
1065017617 10:21476364-21476386 ATCATCTCTCCAGCTAAAGGAGG + Intergenic
1066663295 10:37757309-37757331 GAAATCTCTTCAGCCTAAGATGG + Intergenic
1067005050 10:42652854-42652876 TTAATATGGTCAGATTAAGGGGG - Intergenic
1071718620 10:88120866-88120888 TTCACCTCTTCAGGTGAAGGAGG - Intergenic
1071829516 10:89357703-89357725 TTAATCTATTCAGGCTAAGATGG + Intronic
1072081572 10:92037760-92037782 TTAATATCATCAGGTTAAAGTGG + Intergenic
1072317541 10:94217421-94217443 TTAATCTCATCATATTAAAGTGG + Intronic
1073328542 10:102656558-102656580 TCCATTTCTTCAGCTTAAAGTGG + Intronic
1074244610 10:111676339-111676361 TTAATCTCCTCAGACAAAGGTGG - Intergenic
1074253307 10:111775693-111775715 TTAATCTCTTAACCTTAATTTGG - Intergenic
1076927751 10:133501757-133501779 TTTATCTCTTCAGACAAAGGTGG + Intergenic
1076996996 11:302513-302535 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1076999865 11:317252-317274 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1077714539 11:4568473-4568495 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1078600032 11:12722131-12722153 TTAACCTCTTCAGTTTAAGGAGG + Intronic
1081196841 11:40171724-40171746 TTAATCTAATCAGCTGAAGTAGG + Intronic
1081478405 11:43459962-43459984 TTAATATTTTCAGCTTACGATGG + Intronic
1082701881 11:56442051-56442073 TCAAGCTTTTCAGCTTGAGGTGG + Intergenic
1083587315 11:63869689-63869711 TTAATTTTTTCAGCCTTAGGTGG + Intronic
1084033070 11:66492407-66492429 CTAATCTCTCCAGCTTTAGCAGG - Intronic
1085044717 11:73346169-73346191 TTATTCTCTTCATGTTAGGGAGG - Intronic
1085219318 11:74860060-74860082 TTAATTAATTCAGCTTAAGATGG - Intronic
1086334909 11:85790795-85790817 TTCATCTCTTCACATTAAAGTGG - Intronic
1086798099 11:91134245-91134267 TTACTTTCTTTAGCTTAAGAAGG + Intergenic
1086876932 11:92108436-92108458 TGAAGCTATTCAGCTCAAGGAGG - Intergenic
1087599825 11:100299375-100299397 GTCATCTGTTCAGCTGAAGGAGG + Exonic
1088405070 11:109466714-109466736 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1088763643 11:112956219-112956241 TCATTCTTTTCAGCTGAAGGAGG - Intergenic
1089078319 11:115756690-115756712 CTGATCTCTTCAGATGAAGGTGG - Intergenic
1089149584 11:116354467-116354489 TTAATCCCTTCAGCATTTGGGGG + Intergenic
1090108032 11:123872933-123872955 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1092576050 12:9783484-9783506 TTGATCTTTTCAGCTTTTGGGGG + Intergenic
1095215302 12:39540560-39540582 TTAATCTCTTCAGAATTGGGAGG - Intergenic
1097116867 12:56703955-56703977 TTAATCTCTTCAGAATTGGGTGG - Intergenic
1099082476 12:78202980-78203002 ATAATATCTTCAGATGAAGGCGG + Intronic
1099094520 12:78356516-78356538 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1099593157 12:84621920-84621942 TTATTCTCTTTTGTTTAAGGAGG - Intergenic
1099887250 12:88546901-88546923 TTAATCAATTAACCTTAAGGGGG + Intronic
1099905515 12:88765254-88765276 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1099937649 12:89146800-89146822 TTCATCTCTTCAGCTTGATATGG + Intergenic
1103507191 12:121449455-121449477 CTACTCTCTTCAGCTTGACGTGG - Intronic
1104449647 12:128858723-128858745 TTAATCTCTTCAGGATTGGGAGG - Intronic
1106046563 13:26147408-26147430 TTAATATTTTCAGATTCAGGTGG + Intronic
1107068159 13:36239664-36239686 TTCATCTCTTCATCTTATGGGGG + Intronic
1107721088 13:43248467-43248489 TTAATCTCGTAGGCTGAAGGAGG + Intronic
1108253861 13:48592246-48592268 TTAATCTTTTCAGGATCAGGAGG + Intergenic
1109226512 13:59702662-59702684 GTACTCACTTCATCTTAAGGAGG - Intronic
1109713008 13:66183522-66183544 TTAATCTCCTCAGGCAAAGGTGG + Intergenic
1110815992 13:79860477-79860499 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1111434220 13:88185271-88185293 TTAATCCCATCAGGTTTAGGTGG + Intergenic
1111440766 13:88280658-88280680 TTAATCTCCTCAGACCAAGGTGG - Intergenic
1111479471 13:88804910-88804932 TTTATCTCTTCCACTTAAGATGG - Intergenic
1112924412 13:104656320-104656342 GTAAAATGTTCAGCTTAAGGAGG + Intergenic
1113218254 13:108068727-108068749 TTAATCTCTTCAGAATTGGGAGG - Intergenic
1117001749 14:51377368-51377390 TTTATCTCCTCAGATAAAGGTGG + Intergenic
1117216484 14:53557563-53557585 TTTATCTCTTCAGGCAAAGGTGG - Intergenic
1117633782 14:57721838-57721860 TTTATCTCCTCAGATAAAGGTGG - Intronic
1117804469 14:59476599-59476621 TTATTCTCAGGAGCTTAAGGAGG + Intronic
1118055804 14:62078425-62078447 TTAATATCTTCATTTTATGGAGG - Intronic
1118215144 14:63801938-63801960 TTAATTTATTCATCTTAAGAAGG + Intergenic
1120107516 14:80513922-80513944 TTAATCTCTTCAGGATTGGGAGG - Intronic
1120159797 14:81133560-81133582 TCAACCTCTTCAGCTTAGTGGGG - Intronic
1121731680 14:96191911-96191933 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1122832672 14:104408270-104408292 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1125749963 15:42021371-42021393 TCTATCTCTTCAGCTTATAGAGG + Intronic
1127829752 15:62739962-62739984 TTTATCTGTTCATCTGAAGGAGG - Intronic
1129592581 15:76930860-76930882 TTAATGTGTTCAGGTTGAGGTGG + Intergenic
1131636448 15:94237733-94237755 TTAATCTCTTCAGGATAGGGAGG - Intronic
1133949684 16:10380524-10380546 TTAATCTCTTCAGGATTGGGAGG + Intronic
1134001995 16:10790134-10790156 TTAATCTCTTCAGCATTGGGAGG + Intronic
1139363512 16:66418674-66418696 TTAATCGTGTCACCTTAAGGCGG - Intergenic
1139633078 16:68242292-68242314 TTAATCTCTTCAGGTTTGGGAGG + Intergenic
1143911084 17:10249807-10249829 TTAATCTCTACAGCATTAAGAGG + Intergenic
1144436692 17:15248979-15249001 TTAAGATCTTCAGGTTTAGGAGG + Intronic
1144870837 17:18369740-18369762 TCAACCTCTTCACCTTAAGTGGG - Intergenic
1148009642 17:44466620-44466642 TTAATCTTTTCTGTTTTAGGGGG - Intronic
1149469597 17:56905099-56905121 TTTATTTCTTAAGCTAAAGGTGG + Intronic
1151037956 17:70822757-70822779 TTTATCTCCTCAGATAAAGGTGG + Intergenic
1151594135 17:75066583-75066605 TTGATCACTTCAGCATCAGGCGG + Intergenic
1153130075 18:1845412-1845434 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1153455772 18:5280479-5280501 TTAATCTCTCCCACTTAAGGAGG + Intergenic
1155646386 18:28083256-28083278 TTAGTATCTTCAGCATAGGGTGG - Intronic
1156451935 18:37271580-37271602 TTACTCTCTTCAGCTAAGGCTGG + Intronic
1156585694 18:38428584-38428606 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1156881218 18:42082758-42082780 TAAATATCTTCAGCTTTGGGGGG + Exonic
1158367914 18:56760708-56760730 TGAATATCTTCAGCTTTAGTAGG + Intronic
1158864550 18:61625548-61625570 TTAATCTCTTCAGTATTGGGAGG - Intergenic
1159516198 18:69461481-69461503 TTCATCTCATCTGCTTACGGTGG + Intronic
1159594219 18:70367397-70367419 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1159937988 18:74383760-74383782 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1163869032 19:19802792-19802814 TTAATCTTTTCATCTTAGTGAGG - Intronic
1165368936 19:35390215-35390237 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1165379824 19:35471104-35471126 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1165615535 19:37196643-37196665 TTATGGTCTTCAGGTTAAGGAGG - Intronic
927008568 2:18878564-18878586 TTTATCTCCTCAGATAAAGGTGG - Intergenic
929111059 2:38405470-38405492 TTAATCTCTTTAGGATTAGGAGG + Intergenic
929753635 2:44743809-44743831 TTAATTTGTTGAGGTTAAGGTGG - Intronic
930266590 2:49207422-49207444 TTTATCTCTTTCCCTTAAGGCGG - Intergenic
930536926 2:52654805-52654827 TTAATCTCCTCAGACAAAGGTGG + Intergenic
931687472 2:64806821-64806843 TTAATCTGTTGACCTTGAGGTGG + Intergenic
933387201 2:81625937-81625959 TTAAACTCTTAAGATTAATGAGG - Intergenic
935889683 2:107662667-107662689 TTAATCTCTTCAGGATTGGGAGG + Intergenic
936706898 2:115086155-115086177 TTAATCTCTTCAGAATTGGGAGG - Intronic
937522469 2:122728946-122728968 TTAAGCTCTTCTCCTTAAGGAGG - Intergenic
937852891 2:126651238-126651260 TTTATCTCTTCAGACAAAGGTGG + Intergenic
938828198 2:135027873-135027895 TCAATCTCAGCTGCTTAAGGTGG + Intronic
939763545 2:146215936-146215958 TTACTCTCTTCAGCTCATAGAGG - Intergenic
940146775 2:150553354-150553376 TTAATCTTTTCAGTATAAAGAGG + Intergenic
942233519 2:173881882-173881904 TTATGCTCATCAGCTTAGGGTGG - Intergenic
942751343 2:179291466-179291488 TTCATATTTTCAGCTTAAGTGGG + Intergenic
943373504 2:187046366-187046388 TTAATCTCTTTAGATAAATGAGG - Intergenic
943612585 2:190051287-190051309 ATATTCTCTTCAGCTTAATAAGG - Intronic
943814916 2:192240643-192240665 TTAATCTGTTCAGCTTTACAGGG - Intergenic
944985170 2:205168001-205168023 TCAATCTCATCAGCTTTAGCTGG - Intronic
946133461 2:217625808-217625830 CTAATCTCTTCATCTGAAGGAGG + Intronic
1168823221 20:791309-791331 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1168824966 20:804108-804130 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1168843910 20:928981-929003 TGACTCTGTTCACCTTAAGGTGG + Intergenic
1172086684 20:32390055-32390077 TTAATATTTTCAACTTAAGGTGG - Intronic
1176362269 21:6007663-6007685 TTAATCTCTTTAGGATTAGGAGG + Intergenic
1178196989 21:30357065-30357087 TTAATCTATTCAGCTGAAATTGG - Intronic
1179345398 21:40551531-40551553 TTAATCTCTTCAGGATTGGGAGG + Intronic
1179649602 21:42798966-42798988 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1179761249 21:43530882-43530904 TTAATCTCTTTAGGATTAGGAGG - Intronic
1179915040 21:44471525-44471547 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1180135072 21:45857099-45857121 TTAATCTCTTCAGGATTGGGAGG + Intronic
1180178736 21:46107541-46107563 TTAATCTCTTCAGAATTGGGAGG - Intronic
1180578469 22:16804519-16804541 TTAATCTCTTCAGATTTGGGAGG - Intronic
1182181306 22:28351638-28351660 TTCTGCTCTTCAGCTTGAGGAGG - Intronic
1182973715 22:34602570-34602592 TTAATATCTTGTTCTTAAGGTGG + Intergenic
1184016378 22:41788915-41788937 TTAAGCTCAGCAGGTTAAGGTGG - Intronic
954992830 3:54855754-54855776 TTAATCACTTGAGCAGAAGGGGG - Intronic
957438679 3:80213776-80213798 TTTAGCTCTTCAATTTAAGGAGG + Intergenic
957979522 3:87490839-87490861 ATAATGTCTTCAACTAAAGGTGG - Intergenic
959361159 3:105394140-105394162 TTAATCTTTTCAGCTTTAGGAGG - Intronic
960151322 3:114251553-114251575 TTAGTCTCTCCAGCTTCAGCAGG - Intergenic
961456239 3:127025719-127025741 TTAATTTCATCAGCTTAATGGGG + Intronic
961839375 3:129696104-129696126 TTAATCTCTTCAGGATTGGGAGG - Intronic
963661065 3:148129628-148129650 TTAATCTCTTCAGACAAAGGTGG - Intergenic
966403400 3:179569811-179569833 TTAATCTTTTCAGATGAAGTTGG + Exonic
970629194 4:17922916-17922938 TTAATCTCCTCAGACAAAGGTGG - Intronic
971751966 4:30662028-30662050 TTAATCTCTTCAGGATTGGGAGG - Intergenic
972192573 4:36612730-36612752 TTTATCTCTTCAGACAAAGGTGG - Intergenic
973121345 4:46523787-46523809 TTAATCTCCTCAGACAAAGGTGG + Intergenic
976648169 4:87406993-87407015 TTAATATATTCAGCTAAATGAGG + Intergenic
976835635 4:89369942-89369964 TTAAACTCTTCAGATGAAGATGG - Intergenic
977486324 4:97650709-97650731 TTAATCTCTTCAGGATTGGGAGG + Intronic
978942808 4:114457751-114457773 TTAATGTCTTCAGCGTTGGGAGG + Intergenic
979129366 4:117021882-117021904 TTAATGTCTACTGCTTAAGAAGG - Intergenic
979402967 4:120273490-120273512 TATATCTCTTCAGCTTGAGTAGG + Intergenic
979898776 4:126191859-126191881 TTAATCTCCTCAGACAAAGGTGG + Intergenic
981834524 4:149039911-149039933 TTTATCTCCTCAGATGAAGGTGG - Intergenic
982587683 4:157263153-157263175 TTAAGCTCTTCAATTTAAAGTGG + Intronic
983822796 4:172217154-172217176 TTAATCTCTTCAGGATTGGGAGG + Intronic
984400807 4:179261617-179261639 TTAATCTCCTCAGACAAAGGTGG - Intergenic
984438043 4:179728553-179728575 TTAATCTCTTCAGGATTGGGAGG + Intergenic
985102110 4:186468788-186468810 TTAATCTCTTCAGGATTGGGAGG - Intronic
986781012 5:11065908-11065930 TTAATCTCTTCAGGATGGGGAGG - Intronic
986893083 5:12332669-12332691 TTAATCTCTTCAGGATTGGGAGG + Intergenic
988346586 5:30044284-30044306 TTTATGTTTTCAGGTTAAGGTGG - Intergenic
989511399 5:42291869-42291891 ATAATCTGTTCAGCTTCTGGAGG - Intergenic
990217193 5:53547972-53547994 TTAAACTATTAAGCTTAGGGTGG - Intergenic
990967675 5:61466874-61466896 TTAATTTCTTAAGCTTAATTTGG + Intronic
991315958 5:65307003-65307025 TTAAACTCTTCATTTTAATGTGG + Intronic
991424624 5:66478212-66478234 TTAATCTCTTCAGGATTGGGAGG - Intergenic
993412911 5:87594363-87594385 TTTATCTCCTCAGACTAAGGTGG + Intergenic
993965475 5:94355249-94355271 TTAATCTCTTCAGGATTGGGAGG + Intronic
993983839 5:94573661-94573683 TTAATCTCTTCAGGATTGGGAGG + Intronic
994206294 5:97039737-97039759 TTAATATCTTCAGCTACAGATGG + Intergenic
994722684 5:103399391-103399413 TTAACTTCTTCAGCTTAAGGAGG + Intergenic
995688971 5:114801920-114801942 CTAATCTCTTCATATTCAGGGGG - Intergenic
996165279 5:120215077-120215099 TTAATCTCCTCAGACAAAGGTGG + Intergenic
996333743 5:122360475-122360497 ATAACCTCATCAGCTTAAGATGG + Intronic
996478309 5:123946236-123946258 TTAATCTCTTCAGGATTGGGAGG - Intergenic
996825227 5:127675269-127675291 TTTATCTCTTCAGACAAAGGTGG - Intergenic
997190396 5:131928821-131928843 TTAAGCTCTTCAGTTTAATTAGG - Intronic
998989590 5:147801199-147801221 TTGATCTCTTCAAGTTCAGGGGG + Intergenic
999732525 5:154485326-154485348 TTTGTCTCTTCAGTTTAATGAGG + Intergenic
1000097403 5:157984066-157984088 TTAATCTCTGCAGCCTGGGGTGG + Intergenic
1000223626 5:159237146-159237168 TTAATCTCCTCAGACAAAGGTGG + Intergenic
1002770711 6:288476-288498 CAAATCTCTTCAGCGAAAGGAGG + Intergenic
1010938485 6:81888253-81888275 TTAATCTCCTCAGACAAAGGTGG + Intergenic
1012001613 6:93661913-93661935 TTAATCTCCTCAGACAAAGGTGG - Intergenic
1014315925 6:119864598-119864620 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1014845162 6:126266918-126266940 TTTATCTTTACAGGTTAAGGAGG - Intergenic
1015000997 6:128215501-128215523 ATAATGTATTCAGCTTATGGAGG - Intronic
1016293930 6:142553691-142553713 TTAATATCATCATCTTGAGGGGG - Intergenic
1018077093 6:160227159-160227181 TTAATCTCTTCAGGATTGGGAGG - Intronic
1018835820 6:167483029-167483051 TTAATCTCTTTAGAATTAGGAGG + Intergenic
1019295962 7:275402-275424 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1019715430 7:2536650-2536672 TTTAGGTTTTCAGCTTAAGGTGG - Intergenic
1019741389 7:2676491-2676513 TTTAGGTTTTCAGCTTAAGGTGG + Intergenic
1023578134 7:41652078-41652100 TTCATCTAAACAGCTTAAGGTGG - Intergenic
1024440688 7:49413939-49413961 TTAAGCTCTACTTCTTAAGGTGG - Intergenic
1024823041 7:53356478-53356500 TCAGTCTCTGCAGCTTTAGGAGG + Intergenic
1025108860 7:56195977-56195999 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1026308870 7:69166519-69166541 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1026562221 7:71459755-71459777 GTAATCTCTTCAGGATAGGGAGG - Intronic
1026661450 7:72306294-72306316 TTAATCTCTTCAGGATTGGGAGG - Intronic
1027407145 7:77873610-77873632 TTTATCTCTTCAGACAAAGGTGG + Intronic
1027517823 7:79164468-79164490 TTAATCTCTTCAGTATTGGGAGG - Intronic
1028295526 7:89125120-89125142 TTAATCTCTTCAGCTTAAGGGGG + Intronic
1029931267 7:104373791-104373813 TTAATCTCTTTAGGTTTGGGAGG + Intronic
1030877321 7:114831299-114831321 TTAATCTCTTCAGAATTGGGAGG - Intergenic
1032977775 7:137244667-137244689 ATGATCTCTTCAGATTAAGTGGG + Intronic
1032985093 7:137328844-137328866 GTAATCTCTTGATCATAAGGAGG + Intronic
1033122393 7:138677615-138677637 TTAATCTCTTCAGGATTGGGAGG - Intronic
1033412386 7:141130085-141130107 TTAATCTCTTCAGGATTTGGAGG + Intronic
1033728849 7:144152891-144152913 TAAATCTCTTCTGCATAAGAAGG - Intergenic
1035217222 7:157377160-157377182 TTAATCTCTTCAGGATTGGGAGG + Intronic
1036060992 8:5320700-5320722 TTAATCCCTTCAACATACGGTGG - Intergenic
1037552113 8:19984750-19984772 GGAATCTCTTTAGCTCAAGGAGG + Intergenic
1037975356 8:23206951-23206973 TGCATCGCTTCAGCTTTAGGAGG - Intronic
1038596073 8:28888008-28888030 TTAATGTGTTCAGTTTAAGAAGG - Intronic
1039301198 8:36210476-36210498 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1041366945 8:57116496-57116518 TTAATCTCTTCAAGATTAGGAGG + Intergenic
1041871895 8:62644176-62644198 TTAGTCCCTTCAGCTTTAGGAGG + Intronic
1044019154 8:87083303-87083325 TTAATCTCTTCAGGATTAGGAGG - Intronic
1044286329 8:90415245-90415267 TTAATCTCATCAGACAAAGGTGG + Intergenic
1045792062 8:105995471-105995493 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1047114295 8:121823463-121823485 TTAATCTCTTCAGGATAGGGCGG + Intergenic
1047810836 8:128407102-128407124 CAAATGTCTTCAGCTTAAGGAGG + Intergenic
1048890859 8:138945026-138945048 TCAATCTCTTCATTTTAAAGAGG - Intergenic
1050118396 9:2283612-2283634 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1051271035 9:15355039-15355061 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1051626831 9:19106588-19106610 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1052873944 9:33538328-33538350 TTAATTTATTCACCATAAGGTGG + Intronic
1056390854 9:86140428-86140450 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1057344811 9:94240197-94240219 TTAATTTTTTCATCTTAATGTGG + Intergenic
1058657776 9:107240021-107240043 TTAATCTTTTCAGCTCAAAAAGG + Intergenic
1059065173 9:111076105-111076127 TTCCTTTCTTCAGCTTAGGGTGG - Intergenic
1059523639 9:114968133-114968155 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1185908921 X:3964655-3964677 TTAATCTCTTCAGCATTAGGAGG - Intergenic
1188920426 X:35969510-35969532 GTAATCTCTGCAGCTTAAGGAGG - Intronic
1189358547 X:40330027-40330049 ATAATCTCTTTATCTAAAGGTGG + Intergenic
1190523897 X:51309403-51309425 TCAATCTCTTTAGCTAAGGGAGG + Intergenic
1192094198 X:68193188-68193210 TTCTTCTCTTCAGATTAATGAGG - Intronic
1192132413 X:68564990-68565012 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1192661895 X:73050312-73050334 TTAATCTCCTCAGACAAAGGTGG + Intergenic
1192673574 X:73170932-73170954 TTTATCTCTTCAGGTAAAGGTGG + Intergenic
1192703973 X:73509018-73509040 TTAATCTCTTTAGGTTTAGGAGG + Intergenic
1193053107 X:77122625-77122647 TTTATCTCCTCAGATAAAGGTGG - Intergenic
1193978920 X:88157657-88157679 TTAATCTCCTCAGACAAAGGTGG - Intergenic
1194410590 X:93553045-93553067 TAAATCTCTTCAGGATTAGGAGG + Intergenic
1194520809 X:94916881-94916903 TTAATCTCTTCAGGCAAATGTGG - Intergenic
1196487153 X:116225406-116225428 TTAATCTCTTCAGGATTGGGAGG + Intergenic
1197001968 X:121450497-121450519 TTTATCTCCTCAGATAAAGGTGG - Intergenic
1197074386 X:122337453-122337475 TTTATCTCCTCAGATAAAGGTGG + Intergenic
1197537299 X:127706713-127706735 TTAATCTCCTCAGACAAAGGTGG - Intergenic
1197554599 X:127938105-127938127 TTAATCTCCTCAGACAAAGGTGG + Intergenic
1197720940 X:129744272-129744294 TTAATTTCTTGAGGTTAAGGAGG - Intronic
1197930506 X:131690170-131690192 TTAATCTCTTCAGGTTTAGGAGG + Intergenic
1199275730 X:145939921-145939943 TTAATCTCCTCAGACAAAGGTGG - Intergenic
1199279229 X:145980616-145980638 TTAATCTCTTCAGGATTGGGAGG - Intergenic
1200340630 X:155391640-155391662 TTTATCTCTTCAGGCGAAGGTGG + Intergenic
1201891769 Y:18950193-18950215 TTAATCTCTTTAGGATAGGGAGG + Intergenic