ID: 1028297046

View in Genome Browser
Species Human (GRCh38)
Location 7:89146767-89146789
Sequence TGTAATCTGAGTACTTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405650
Summary {0: 1, 1: 32, 2: 1730, 3: 37441, 4: 366446}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028297042_1028297046 -2 Left 1028297042 7:89146746-89146768 CCAGGTGTGTTGGTTCATGCCTG 0: 4
1: 476
2: 11661
3: 45357
4: 115451
Right 1028297046 7:89146767-89146789 TGTAATCTGAGTACTTCGGGAGG 0: 1
1: 32
2: 1730
3: 37441
4: 366446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028297046 Original CRISPR TGTAATCTGAGTACTTCGGG AGG Intronic
Too many off-targets to display for this crispr