ID: 1028297414

View in Genome Browser
Species Human (GRCh38)
Location 7:89151770-89151792
Sequence TAGGCTCTTTAACATGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028297406_1028297414 28 Left 1028297406 7:89151719-89151741 CCTGAAAGTGAGTGGCACAGCCC 0: 1
1: 0
2: 3
3: 41
4: 308
Right 1028297414 7:89151770-89151792 TAGGCTCTTTAACATGGCAATGG No data
1028297409_1028297414 6 Left 1028297409 7:89151741-89151763 CCATAAGCCAAATTTAAAGAACC 0: 1
1: 0
2: 0
3: 20
4: 169
Right 1028297414 7:89151770-89151792 TAGGCTCTTTAACATGGCAATGG No data
1028297408_1028297414 7 Left 1028297408 7:89151740-89151762 CCCATAAGCCAAATTTAAAGAAC 0: 1
1: 0
2: 0
3: 30
4: 256
Right 1028297414 7:89151770-89151792 TAGGCTCTTTAACATGGCAATGG No data
1028297410_1028297414 -1 Left 1028297410 7:89151748-89151770 CCAAATTTAAAGAACCTTTTGTT 0: 1
1: 0
2: 1
3: 34
4: 389
Right 1028297414 7:89151770-89151792 TAGGCTCTTTAACATGGCAATGG No data
1028297407_1028297414 8 Left 1028297407 7:89151739-89151761 CCCCATAAGCCAAATTTAAAGAA 0: 1
1: 0
2: 1
3: 38
4: 402
Right 1028297414 7:89151770-89151792 TAGGCTCTTTAACATGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028297414 Original CRISPR TAGGCTCTTTAACATGGCAA TGG Intronic
No off target data available for this crispr