ID: 1028298665

View in Genome Browser
Species Human (GRCh38)
Location 7:89169134-89169156
Sequence TTCACTCCTCCGGATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028298665_1028298673 3 Left 1028298665 7:89169134-89169156 CCTGCCCCATCCGGAGGAGTGAA 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1028298673 7:89169160-89169182 CAATGGCAGGTCTGTGATGGTGG No data
1028298665_1028298671 -10 Left 1028298665 7:89169134-89169156 CCTGCCCCATCCGGAGGAGTGAA 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1028298671 7:89169147-89169169 GAGGAGTGAAAGTCAATGGCAGG 0: 1
1: 2
2: 15
3: 60
4: 344
1028298665_1028298672 0 Left 1028298665 7:89169134-89169156 CCTGCCCCATCCGGAGGAGTGAA 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1028298672 7:89169157-89169179 AGTCAATGGCAGGTCTGTGATGG 0: 1
1: 5
2: 32
3: 78
4: 268
1028298665_1028298677 19 Left 1028298665 7:89169134-89169156 CCTGCCCCATCCGGAGGAGTGAA 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1028298677 7:89169176-89169198 ATGGTGGGGAACAGCAGTGGTGG No data
1028298665_1028298676 16 Left 1028298665 7:89169134-89169156 CCTGCCCCATCCGGAGGAGTGAA 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1028298676 7:89169173-89169195 GTGATGGTGGGGAACAGCAGTGG 0: 1
1: 0
2: 8
3: 81
4: 385
1028298665_1028298675 5 Left 1028298665 7:89169134-89169156 CCTGCCCCATCCGGAGGAGTGAA 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1028298675 7:89169162-89169184 ATGGCAGGTCTGTGATGGTGGGG No data
1028298665_1028298674 4 Left 1028298665 7:89169134-89169156 CCTGCCCCATCCGGAGGAGTGAA 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1028298674 7:89169161-89169183 AATGGCAGGTCTGTGATGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028298665 Original CRISPR TTCACTCCTCCGGATGGGGC AGG (reversed) Intronic
902691285 1:18111194-18111216 TTAACTCCCCCAGTTGGGGCTGG - Intronic
904039135 1:27574332-27574354 TCTATTCCTCAGGATGGGGCTGG + Intronic
904397182 1:30229837-30229859 TCCACCCCTCCGGATCCGGCAGG + Intergenic
904767526 1:32861950-32861972 TTTTCCCCTCTGGATGGGGCTGG - Intergenic
908843803 1:68304412-68304434 TTGACTCCTCTGGAAGAGGCAGG + Intergenic
909374508 1:74924308-74924330 TTCACTCTTCCTCAAGGGGCGGG + Intergenic
911158119 1:94656296-94656318 TCCACCCCTCTGAATGGGGCAGG - Intergenic
911172452 1:94783818-94783840 TTCACTCCTGTGGCTAGGGCAGG + Intergenic
912680000 1:111723102-111723124 TTAACTGCACCGGATGGGGAAGG + Exonic
917403526 1:174678885-174678907 TCCATCCCTCCGGATAGGGCAGG - Intronic
920639845 1:207741472-207741494 TCCATTCCTCCGGATCCGGCAGG - Intergenic
922685152 1:227633116-227633138 TCCACCCCTCCGGATCCGGCAGG - Intronic
1064312395 10:14223186-14223208 TCCACATCTCCGGATGGAGCAGG + Intronic
1065222791 10:23513331-23513353 TTCACCACTCCGGATCCGGCAGG - Intergenic
1068791289 10:61034006-61034028 TCCACCCCTCCGGATCTGGCAGG - Intergenic
1068792064 10:61039471-61039493 TCCACCCCTCCGGATATGGCAGG - Intergenic
1068937142 10:62647157-62647179 TTGACTCTTCCTGATGGGGGTGG + Intronic
1069376050 10:67794161-67794183 TACACTTCTCCGGCTGGAGCAGG - Intergenic
1069727855 10:70592808-70592830 TTCTGGCCTCCTGATGGGGCAGG + Intergenic
1071326719 10:84525688-84525710 TCCACCCCTCCGGATCTGGCAGG - Intergenic
1072714710 10:97743038-97743060 GTCACTCCTCCAGCTGGGGAGGG - Intronic
1073193712 10:101670779-101670801 TTCACATCTCAGGATGGGGCTGG + Intronic
1074892578 10:117747878-117747900 TTCACTCACCGGGATGGGGATGG - Intergenic
1077443147 11:2577988-2578010 TGCACTCCTCAGGACAGGGCAGG - Intronic
1079290666 11:19185117-19185139 GTCACTCCTCTGGATGCTGCTGG - Intronic
1079353888 11:19714492-19714514 GTCACCCCGCAGGATGGGGCAGG - Intronic
1079601737 11:22317895-22317917 TCCATCCCTCCGGATGCGGCAGG - Intergenic
1080932680 11:36829183-36829205 TTCACTCAGCATGATGGGGCTGG - Intergenic
1083750550 11:64758506-64758528 CTCACTCCTCCAGCTGGGCCTGG - Exonic
1085402129 11:76241539-76241561 CTGCCTCTTCCGGATGGGGCAGG + Intergenic
1085900971 11:80699524-80699546 TCCACCCCTCCGGATCCGGCAGG - Intergenic
1088973577 11:114794858-114794880 GTTACTCCTCAGGATGGGGTTGG - Intergenic
1090048696 11:123358643-123358665 TCCCCTCCTCCAGATGGGACTGG + Intergenic
1092293648 12:7181312-7181334 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1095829602 12:46570033-46570055 TGCACTGCTCCGGATTGGGAGGG - Intergenic
1096481704 12:51946128-51946150 TTCACTCCTCAGGCTGGGCGCGG - Intergenic
1098984879 12:77001494-77001516 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1099605039 12:84794137-84794159 TCCACCCCTCCGGATCCGGCAGG + Intergenic
1103802561 12:123548839-123548861 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1103872335 12:124100796-124100818 TCCACCCCTCCGGATCCGGCAGG - Intronic
1105823527 13:24101137-24101159 TCCACTCCTCCTGATGGCCCTGG + Intronic
1106251690 13:27986863-27986885 TTCACTCATCAGGCTGGGACTGG + Intronic
1107119187 13:36778821-36778843 TCCACTCCTCCTGATGGGGCAGG + Intergenic
1107346124 13:39462860-39462882 TTCATTCTTCGGGATGGGGCTGG + Intronic
1107556419 13:41519928-41519950 TTGGCTTCTCCTGATGGGGCTGG - Intergenic
1107869329 13:44732667-44732689 TCCATTCCTCAGGGTGGGGCCGG - Intergenic
1110268144 13:73563081-73563103 TTCACTCCTCTACATGAGGCTGG + Intergenic
1110720997 13:78761564-78761586 TGCACTTCTCTGGATGGAGCAGG - Intergenic
1116930853 14:50689041-50689063 TTCCCTCCTCTGGCTAGGGCTGG + Intergenic
1120637894 14:86974238-86974260 TTCACTCCTCCTCATAGGGCAGG + Intergenic
1121533413 14:94674149-94674171 TTCACTCCTCTGGTGGGGGTGGG - Intergenic
1122884058 14:104702748-104702770 TTCACAGCTCCAGATGGGGTGGG + Intronic
1123987299 15:25657075-25657097 TCCACCCCTCCGGATCCGGCAGG + Intergenic
1125676315 15:41504205-41504227 TTCACTCCTGCCAATGGAGCTGG - Exonic
1128217053 15:65941857-65941879 TTCACCCCTCCAGACAGGGCTGG + Intronic
1140214948 16:72999834-72999856 TCCACTCCACCAGATAGGGCAGG - Intronic
1142153123 16:88521423-88521445 TTCTCACCTGGGGATGGGGCTGG - Intronic
1147407709 17:40224725-40224747 TTCACTGCTTCAGATGGGGAGGG + Intronic
1152461585 17:80444852-80444874 CTCACTCCCCCGAATGGGGGTGG - Intergenic
1155089191 18:22489608-22489630 TGCTCTCCTCAGGATGGAGCAGG - Intergenic
1155921816 18:31611060-31611082 TTCACTCCCCAGGAGGGGGAGGG + Intergenic
1157097245 18:44697078-44697100 GTGACTCCTCCTGAGGGGGCGGG - Intronic
1161044211 19:2126320-2126342 TCCACACCTCCGGCTGGGCCAGG - Intronic
1164595090 19:29526986-29527008 TGCTTCCCTCCGGATGGGGCGGG - Intronic
1165092028 19:33392627-33392649 GTCACTCCGCCTGGTGGGGCTGG - Intronic
1166808195 19:45499342-45499364 TTCACGCCTCCGCTTGGGCCTGG + Exonic
925067629 2:940760-940782 TTCACACCCCTGGATGGGGTTGG - Intergenic
926168915 2:10538539-10538561 TTCATTCCTCAGGATGGAGTTGG + Intergenic
928676637 2:33657587-33657609 TTCACCCCTCCGGATCTGGCAGG + Intergenic
929876845 2:45803958-45803980 TTCCCTCTCCTGGATGGGGCAGG - Intronic
931239360 2:60438777-60438799 TTCACTCTTCAGGAGGTGGCTGG + Intergenic
939976189 2:148719958-148719980 TCCACTCCTCCTTGTGGGGCGGG - Intronic
942686267 2:178535525-178535547 TTGACTCCTCTGGGTGGGTCAGG + Exonic
944039786 2:195339895-195339917 TCCACCCCTCCGGATCTGGCAGG - Intergenic
948207736 2:236171535-236171557 CTTCCTCCTCCGGATTGGGCTGG - Intergenic
949035664 2:241814740-241814762 TGCACACCCCGGGATGGGGCGGG + Intronic
1169293632 20:4374104-4374126 TTTCCTCCTGGGGATGGGGCAGG - Intergenic
1173276254 20:41586285-41586307 TTCACCCCTCCGGATCCGGCAGG + Intronic
1175852928 20:62103654-62103676 TTCACTCCTCAGGCCTGGGCTGG + Intergenic
1177738131 21:25118821-25118843 TCCACCCCTCCGGATCCGGCAGG + Intergenic
1183541806 22:38433792-38433814 CTAATTCCTCAGGATGGGGCAGG - Intronic
1184055234 22:42043099-42043121 TTCACTCCTCAGGAGTGGGTGGG + Intronic
1184251440 22:43262596-43262618 TTCTCTCCACCCCATGGGGCTGG + Intronic
1185346620 22:50313377-50313399 TTCCCTCCTCCGGGTGAGGAAGG + Intronic
949362435 3:3245602-3245624 TTCTCACCTCTGAATGGGGCAGG - Intergenic
951582332 3:24179116-24179138 TTCATTCCTCTAGATAGGGCTGG - Intronic
952921709 3:38289736-38289758 TCCACCCCTCCGGATCTGGCAGG - Intronic
954096962 3:48336055-48336077 TCCACACCTCCGGATTGGGCAGG - Intergenic
956295659 3:67710598-67710620 TTCCCTCCTCTGGGTGGTGCTGG + Intergenic
957687049 3:83515333-83515355 TCCATCCCTCCGGATGCGGCAGG + Intergenic
963710488 3:148741599-148741621 TTCAACCCTCCCGATAGGGCTGG + Exonic
964759982 3:160126091-160126113 TTCCCTCCTGGGTATGGGGCAGG + Intergenic
965054287 3:163694793-163694815 GTCACTCCTCTGGATCAGGCAGG - Intergenic
966511217 3:180765630-180765652 TTCACCCCTCCGGATCCGGCAGG - Intronic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
968803460 4:2757436-2757458 TTCCCTACTCAGGATAGGGCAGG + Intergenic
969254074 4:5990722-5990744 GTCACTCCTCCGCATGGACCTGG - Intergenic
969674600 4:8607872-8607894 TGGGCTCCTCCGGATGGGGAAGG + Intronic
972594018 4:40514433-40514455 TTCCCTTCTGCGGAAGGGGCAGG - Intronic
974775660 4:66476922-66476944 TCCAAACCTCTGGATGGGGCAGG - Intergenic
975418814 4:74138633-74138655 TCCACTCCTCCGGATCCAGCAGG - Intronic
976190174 4:82479758-82479780 TCCACCCCTCCGGATCCGGCAGG + Intergenic
976266518 4:83190543-83190565 TTTCCTCCTGGGGATGGGGCAGG + Intergenic
976464845 4:85355198-85355220 TCCACCCCTCCGGATCTGGCAGG - Intergenic
977556182 4:98489623-98489645 TCCACCCCTCCGGATCCGGCAGG + Intronic
978818393 4:112935384-112935406 TTGAGTCCTTCTGATGGGGCAGG + Intronic
982067296 4:151665623-151665645 TTCACTCCCCCGAATCGTGCAGG - Intergenic
984838206 4:184041775-184041797 TTCAATACTCCGCTTGGGGCTGG + Intergenic
985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG + Intergenic
987848269 5:23316147-23316169 TTCAGTACTCTGGATGGGGAGGG - Intergenic
988117713 5:26919225-26919247 TTCACTCCTCACCATGTGGCTGG - Intronic
988492977 5:31720747-31720769 TTTCCTCCTGGGGATGGGGCAGG + Intronic
988609559 5:32711977-32711999 TTCACTCACCCGGGTGCGGCCGG + Exonic
989426473 5:41301745-41301767 TTCACTCATAGGGATGGGGCTGG + Intergenic
992648143 5:78831342-78831364 TTCACTCCACTGGAGGGTGCTGG - Intronic
993941850 5:94068347-94068369 TCCACCCCTCCGGATCTGGCAGG - Intronic
995717284 5:115092661-115092683 TCCACCCCTCCGGATCTGGCAGG + Intergenic
996416013 5:123211160-123211182 TTCAATCCTCAGGAAGGGGTAGG - Intergenic
998122118 5:139587294-139587316 TCCATCCCTCCGGATGGAGCAGG - Intronic
999125027 5:149240188-149240210 TTCTGCCCTCCGGATGGGGCAGG - Intronic
1005098953 6:22148268-22148290 TGCATTCCTGCGGATGGGGCTGG + Intergenic
1014243346 6:119041703-119041725 TCCACCCCTCCGGATCCGGCAGG + Intronic
1021144259 7:17065946-17065968 TCCACCCCTCCAGATCGGGCAGG + Intergenic
1022947599 7:35302922-35302944 TTCAAGCCACAGGATGGGGCAGG - Intergenic
1023439767 7:40173322-40173344 TCCACCCCTCCGGATCTGGCAGG - Intronic
1024114777 7:46182339-46182361 TTCCCTCTGCCTGATGGGGCAGG + Intergenic
1027195495 7:76027278-76027300 TCCACTCCTCAGGATGGGGAAGG + Intronic
1027677957 7:81182297-81182319 TTTACCCCTCCGGATCTGGCAGG - Intronic
1028298665 7:89169134-89169156 TTCACTCCTCCGGATGGGGCAGG - Intronic
1029474660 7:100775936-100775958 GCCACTCCTCAGGATGGAGCAGG + Intronic
1031254323 7:119428518-119428540 TTCACTACTTCTCATGGGGCAGG + Intergenic
1033099668 7:138460017-138460039 TTCAGGCGTCCGGAGGGGGCGGG + Intergenic
1033343865 7:140512441-140512463 TTCACTCCTGTCCATGGGGCTGG + Intergenic
1037596045 8:20354924-20354946 GGCACCCCTGCGGATGGGGCAGG + Intergenic
1037858763 8:22389929-22389951 TGCCCTCCTCTGGGTGGGGCAGG + Intronic
1038605927 8:29004411-29004433 TTCACTCCTCAGGAAGTGGAAGG + Intronic
1039753460 8:40498032-40498054 TTCACTTCTCTGGAGTGGGCTGG + Intergenic
1042292933 8:67188699-67188721 TCCACCCCTCCGGATCTGGCAGG + Intronic
1042523587 8:69741413-69741435 TTCACTCCTACGGAGGGTACAGG - Intronic
1047443555 8:124900101-124900123 TTCACCCCTCTGGATCTGGCAGG - Intergenic
1047618318 8:126581367-126581389 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1047722304 8:127652465-127652487 TTCACACATCTGGATGGGGCTGG + Intergenic
1049232502 8:141491788-141491810 TCCACTCCTGCGGAATGGGCAGG + Intergenic
1050116053 9:2264561-2264583 TCCACCCCTCCGGATCCGGCAGG - Intergenic
1050847453 9:10240006-10240028 TTCCCTCCTCAGTATGGGGTAGG - Intronic
1053215198 9:36265055-36265077 TCCACCCCTCCGGATCTGGCAGG + Intronic
1057381271 9:94569526-94569548 TCCACTCCTGGGGCTGGGGCCGG + Intronic
1059023297 9:110598934-110598956 TCCACTCCTGCTCATGGGGCAGG - Intergenic
1061862234 9:133473929-133473951 CCCACTCCTCCGCATGGGTCAGG - Intronic
1062134603 9:134918402-134918424 TTTACTCCACCGAATGGGGCTGG - Intergenic
1185560918 X:1060118-1060140 TCCACCCCTCCGGATCAGGCAGG + Intergenic
1187283567 X:17881773-17881795 TTCACTCCTCTAAAGGGGGCTGG + Intergenic
1190971802 X:55356912-55356934 TCCACTCCTCCTCATTGGGCAGG + Intergenic
1192584599 X:72309136-72309158 TTCAATGGTCCGGATGGGGGAGG - Intergenic
1192763825 X:74123106-74123128 TTCACTGCTATTGATGGGGCTGG + Intergenic
1192803103 X:74485840-74485862 TCCACCCCTCCGGATCCGGCAGG - Intronic
1194506393 X:94738917-94738939 TTCACTCCTCCTCATAGGGTGGG - Intergenic
1195243674 X:102977855-102977877 TTCACCCCTCCGGATCCAGCAGG + Intergenic
1195505076 X:105647191-105647213 TCCACCCCTCCGGATCTGGCAGG - Intronic