ID: 1028298869

View in Genome Browser
Species Human (GRCh38)
Location 7:89171246-89171268
Sequence TTGTAGTAACTCAATGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028298867_1028298869 -10 Left 1028298867 7:89171233-89171255 CCTTATTTGTTCCTTGTAGTAAC 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1028298869 7:89171246-89171268 TTGTAGTAACTCAATGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028298869 Original CRISPR TTGTAGTAACTCAATGAAGT AGG Intronic
No off target data available for this crispr