ID: 1028303229

View in Genome Browser
Species Human (GRCh38)
Location 7:89228715-89228737
Sequence CTCCACCTGCACCCCGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 2, 2: 18, 3: 50, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028303229_1028303240 27 Left 1028303229 7:89228715-89228737 CCCACACCGGGGTGCAGGTGGAG 0: 1
1: 2
2: 18
3: 50
4: 246
Right 1028303240 7:89228765-89228787 CACACTCCTCAGCCCTTGGGTGG 0: 169
1: 616
2: 774
3: 321
4: 293
1028303229_1028303236 23 Left 1028303229 7:89228715-89228737 CCCACACCGGGGTGCAGGTGGAG 0: 1
1: 2
2: 18
3: 50
4: 246
Right 1028303236 7:89228761-89228783 CGCCCACACTCCTCAGCCCTTGG 0: 85
1: 384
2: 658
3: 675
4: 627
1028303229_1028303237 24 Left 1028303229 7:89228715-89228737 CCCACACCGGGGTGCAGGTGGAG 0: 1
1: 2
2: 18
3: 50
4: 246
Right 1028303237 7:89228762-89228784 GCCCACACTCCTCAGCCCTTGGG 0: 152
1: 479
2: 730
3: 612
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028303229 Original CRISPR CTCCACCTGCACCCCGGTGT GGG (reversed) Intronic
900550414 1:3251660-3251682 CTCCCCTTGCACCCTGCTGTGGG - Intronic
900558688 1:3292778-3292800 CTCCACCAGCACATCGGTGGGGG + Intronic
900685684 1:3946236-3946258 CACCTCCTGCACCCCTGCGTGGG + Intergenic
900931571 1:5741304-5741326 CTCCACCTGGAGCCAGGTGAGGG + Intergenic
901601398 1:10426308-10426330 CTCCACCTGCAGCCTGGTGCAGG - Intergenic
902192934 1:14776292-14776314 CTGCACCTGGACTCCGTTGTGGG + Intronic
902783911 1:18720998-18721020 CACCACCTGCTCCCCCATGTTGG + Intronic
903104899 1:21068330-21068352 CTGCACCTGCACTCCAGTCTGGG + Intronic
903107744 1:21098691-21098713 CTGCAACTGCACTCCAGTGTGGG - Intronic
904830079 1:33300704-33300726 CTGTACCTGCACCCGGGTGGCGG + Exonic
905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG + Intergenic
906315925 1:44786406-44786428 CGCCACCTGCATCCGGCTGTGGG + Intronic
907371085 1:54004173-54004195 CTCCACCCGCGGCCCGGTGCGGG - Intergenic
910455293 1:87391263-87391285 CACCACCTAAACCCGGGTGTAGG - Intergenic
912819301 1:112854462-112854484 CTCCACCTGCAGCCCCGTGCGGG - Intergenic
913593938 1:120355312-120355334 CACCACCTTCACCTCCGTGTAGG + Intergenic
914596849 1:149162597-149162619 CACCACCTTCACCTCCGTGTAGG - Intergenic
918102260 1:181386761-181386783 TTCCTCCTGCACCCCCATGTAGG + Intergenic
918511946 1:185321664-185321686 CTCCACCTGTGCCCCTGTGCAGG - Intergenic
918993957 1:191732182-191732204 CTCCACCTGCGGCCCGGTGTGGG + Intergenic
919134153 1:193487911-193487933 CTCCACCTGCAGCCTGTTCTTGG - Intergenic
919386942 1:196934121-196934143 CTCCCCCTGCAGCCAGGTGTGGG + Intronic
920881954 1:209888897-209888919 CTCCACCTGCAGCCCGGGTGCGG - Intergenic
921155010 1:212432788-212432810 CGCCTCCTGCGCCCCGGGGTGGG - Intergenic
921358104 1:214305449-214305471 CTTCTCCTGCACCTCGATGTTGG - Intronic
921364117 1:214357821-214357843 AGCCACCTGCACCCCTGTGGGGG + Exonic
921396306 1:214673096-214673118 CTCCACCTGCAGCCCGGGTGCGG - Intergenic
922884313 1:229006392-229006414 CTCCACCTCCCCTCCTGTGTGGG + Intergenic
923010457 1:230083970-230083992 CTCCATCAGCACCCGGATGTTGG + Intronic
923627362 1:235624999-235625021 ATCCACCAGCACCTCAGTGTGGG - Intronic
923929186 1:238674163-238674185 CTCCACCAGCACCCTAGTTTTGG + Intergenic
924219164 1:241855529-241855551 CTTCACCTGCAGCCCCGTGCGGG - Intronic
1064956459 10:20916441-20916463 CTGCACCTGCACTCCAGTCTGGG - Intronic
1068863243 10:61868055-61868077 CTCCACCTGCAGCCCGGTGCAGG + Intergenic
1069090735 10:64196721-64196743 CTCCACCTGCGGCCCGGTGTGGG - Intergenic
1069827519 10:71263150-71263172 CACTGCCTCCACCCCGGTGTGGG - Intronic
1070764217 10:79047304-79047326 CTCCTCCAGCAGCCCAGTGTAGG - Intergenic
1071525434 10:86355457-86355479 CTTCTCCTCCACCCAGGTGTGGG - Intronic
1073458291 10:103650914-103650936 GTCCACGTGCACCCCAGTGCTGG + Intronic
1073532588 10:104245584-104245606 CTCCACCTGCAGCCCTGTGCAGG + Intronic
1075114785 10:119617086-119617108 CTCCACCAGCGCCCCCGCGTGGG - Intergenic
1075651099 10:124128737-124128759 GTCCACCTCCACCGCGGTGCTGG - Intergenic
1076247841 10:128961507-128961529 CTCCACCTCCACACAGGTGCTGG - Intergenic
1076447657 10:130528687-130528709 CTCCACCTCCAGCCCGACGTGGG - Intergenic
1077815674 11:5683319-5683341 CTCCACCTGCGGCCCGGTGCAGG + Intronic
1079756735 11:24274232-24274254 CTCCACCTGCGGCCTGGGGTGGG - Intergenic
1080503014 11:32888161-32888183 CTCCACCTGCTGCCTGGTGCGGG - Intergenic
1081329636 11:41788174-41788196 CTCCACTTGCGGCCCAGTGTGGG - Intergenic
1081713799 11:45234415-45234437 CTCCACCTGCAGCCCAGGGCGGG + Intronic
1082734988 11:56845602-56845624 CTCCACCTGCAGCCCCCTGTGGG + Intergenic
1082833741 11:57638105-57638127 CTTCACCTGCAGCCCTGTGCGGG + Intergenic
1083753769 11:64778276-64778298 CTCCGCCTGCACCCGGGCCTGGG - Exonic
1084323522 11:68386388-68386410 GTCCACCTGCAGCACGATGTCGG - Exonic
1084891030 11:72237326-72237348 CACCACCGGCACCCTCGTGTGGG + Exonic
1085687768 11:78639267-78639289 CTCCGCCTGCAGCCCTGTGCAGG + Intergenic
1086034980 11:82404302-82404324 CTCCACCAGCTCCCCGGTGCGGG + Intergenic
1088440508 11:109865757-109865779 CTGCCCCTGCACACCAGTGTGGG - Intergenic
1088481641 11:110300885-110300907 CTCTACCTGCCCCCTGGTGCGGG - Intergenic
1089029983 11:115315954-115315976 CTCCTCTTGCTTCCCGGTGTTGG + Intronic
1089574949 11:119435429-119435451 CTCCACATGCAGCCCCTTGTGGG - Intergenic
1089653814 11:119932830-119932852 CTCTAACTGCACCCAGGTGAGGG + Intergenic
1089984616 11:122801538-122801560 CTCCAGCCTCACCCCCGTGTTGG + Intronic
1090133488 11:124170670-124170692 CTCCACCTGCAGCCCGGTGCGGG - Intergenic
1090588317 11:128237456-128237478 CTCCACCTGCAGCCCATTGCGGG + Intergenic
1094448798 12:30562044-30562066 CTCCACCTGCAGCCCGGGTGCGG + Intergenic
1099450516 12:82801985-82802007 CTCCACCTGTGCCCCCGTGCAGG - Intronic
1102948491 12:117011232-117011254 CGCCACCTGCAGCCCGGGGCCGG - Intronic
1103086643 12:118066537-118066559 CTCCACCTGCACCCCTGGCGGGG - Exonic
1107467621 13:40665083-40665105 CTCCACCTGCAGCCCGGTCCCGG + Intronic
1108685392 13:52815206-52815228 CTCCACCTGCCGCCTGGTGCGGG - Intergenic
1108856467 13:54799672-54799694 CTCCACCTGCAGCCCTGTGGGGG - Intergenic
1111747744 13:92291257-92291279 CTCCACCTGCCGCCCTGTGCAGG + Intronic
1111841339 13:93454735-93454757 CTCCACCTGCAGCCCGGGTGCGG - Intronic
1112496918 13:99912560-99912582 ATCCTCCTGCAGCCCAGTGTTGG - Intergenic
1113494217 13:110714667-110714689 CTCCTCCTGCAGCCCCGTCTCGG - Intronic
1113767842 13:112892075-112892097 CTCCACCTGCACACCGTGGACGG - Intergenic
1114155626 14:20099609-20099631 CTCCACCTGCAGCTGGGTGCGGG + Intergenic
1114559796 14:23581170-23581192 CTCCACCTGCGGCCTGGTGGGGG + Intergenic
1114674407 14:24430879-24430901 CTCCAGCTGCAGCCAGATGTGGG - Exonic
1116390599 14:44385154-44385176 CTCCACCTGCGCCCCGGTTGGGG + Intergenic
1116653836 14:47626917-47626939 CTCCACCTGCACCCCGGTGCGGG + Intronic
1116901035 14:50362307-50362329 CTCCACCTGTGGCCTGGTGTGGG + Intronic
1118949479 14:70421135-70421157 CTCTACCTGCACCCTGATCTTGG - Intergenic
1120229690 14:81829413-81829435 CTCCACCTGCAGCCAGGTGCAGG - Intergenic
1122346933 14:101066617-101066639 TTCCACCTGCAGCCCTGTGCTGG + Intergenic
1122923975 14:104891451-104891473 CTGCGCCTCCACCCCAGTGTGGG - Intronic
1122969115 14:105145285-105145307 CTCCACCTGCAGGCCAGTGGGGG + Intronic
1124110545 15:26781617-26781639 CTCCACCTGCACCCCCGTGCGGG - Intronic
1124387783 15:29224742-29224764 CTCCACCTGCGGCCCGGTGCCGG - Intronic
1125631666 15:41152051-41152073 CTCCACCTGCGCCCCGGTGGGGG + Intergenic
1126736219 15:51734441-51734463 CTCCATCTTCACCCCCTTGTCGG + Intronic
1128090802 15:64917400-64917422 CTGCACCTGCAGCCCAGTGCAGG - Exonic
1128594033 15:68928903-68928925 CTCCACCTGCGCCTGGGTGTGGG - Intronic
1129777431 15:78246086-78246108 CTCCACCTGCAGCCCGGGTGCGG - Intergenic
1130101798 15:80900078-80900100 CCCCATCTGCACCCCAGGGTGGG + Intronic
1133320385 16:4909940-4909962 CTCCACCTGCAGGCCGATGCTGG + Intronic
1133744040 16:8674223-8674245 CTCCACCTCCACCCGCGTCTCGG - Intergenic
1134570126 16:15283851-15283873 CTCCACCTGCACCCCTGCATAGG + Intergenic
1134732250 16:16472198-16472220 CTCCACCTGCACCCCTGCATAGG - Intergenic
1134935187 16:18239765-18239787 CTCCACCTGCACCCCTGCATAGG + Intergenic
1135496694 16:22957577-22957599 CTCCGCCTGCACCTCAGTGTAGG - Intergenic
1136116421 16:28097603-28097625 CTCCCCCTGCCCCCCAGGGTGGG - Intergenic
1137459560 16:48648205-48648227 ATCCCCCTGCACTCCAGTGTGGG - Intergenic
1139797415 16:69494969-69494991 CTCCACCACCACCCGGTTGTGGG + Intergenic
1140034356 16:71361115-71361137 CTCCCCCTTCACCCCGGAGCAGG - Intronic
1140303415 16:73780182-73780204 CTGCACCTGCACCCCAGCTTGGG - Intergenic
1140694263 16:77516746-77516768 CACCACCTGCAACCCAGTCTTGG + Intergenic
1141507642 16:84489312-84489334 CAGCACCTGCACCCGGGGGTTGG + Exonic
1141692708 16:85605647-85605669 CTCCCCCTGCACCCCCGGGGGGG + Intergenic
1142898607 17:2998324-2998346 CTCGACCTGCACGACGATGTAGG - Exonic
1143250447 17:5519486-5519508 CCCCCCCTGCACTCCAGTGTGGG - Intronic
1143552797 17:7641248-7641270 CTCCACCTGCGGCCTGGTGCTGG + Intergenic
1144128154 17:12221275-12221297 CTCCACCTGCAGCCCCGAGCAGG + Intergenic
1145237805 17:21221420-21221442 CTCCCCCAGCACCCCTGTGGTGG + Intergenic
1145392950 17:22470091-22470113 CTCCACCTGCAACTCTGTGGAGG - Intergenic
1145939972 17:28738097-28738119 CTCCGCCTGCACCTAGGGGTGGG - Exonic
1146789494 17:35743341-35743363 CTCCACCTCAACCCAGGTCTTGG + Exonic
1147717785 17:42519876-42519898 CTCAGCCTGCACCCCAGTGAAGG + Intronic
1148690563 17:49524665-49524687 CTCTACCTCCACCCCCATGTTGG - Intergenic
1151599923 17:75099940-75099962 TTCCACCTGCACCCAGGGGTGGG - Intronic
1151866505 17:76806527-76806549 CTCCACTTGCGGCCCAGTGTGGG + Intergenic
1151979340 17:77499391-77499413 CAGCACCTGCAGCCCGGTGGGGG - Exonic
1152071768 17:78137700-78137722 CTTCCCCTGCACCCCAGTGCTGG + Exonic
1152085319 17:78214406-78214428 CTGCGCCTGCACCCCGGAGCGGG + Exonic
1153927016 18:9843189-9843211 CTCCTCCTGCACCCCATTGTGGG + Intronic
1154294042 18:13134633-13134655 TTCCACCTGCGCCCCACTGTGGG - Intergenic
1154507879 18:15060650-15060672 CTGCAGCTGCACCCGGGAGTGGG - Intergenic
1154942900 18:21132485-21132507 CTCCACCTGCGGCCCAGTGCGGG - Intergenic
1156943239 18:42795641-42795663 CTCCACCTGCAGCCCGGGTGCGG + Intronic
1159109877 18:64043392-64043414 CTGCACCTGCAGCCCGGTGCAGG + Intergenic
1159188045 18:65004234-65004256 CTCCACGTGCACCTGGGTGTAGG + Intergenic
1160040132 18:75337580-75337602 CCCCACCTGCAGCCCCATGTTGG - Intergenic
1164789827 19:30966638-30966660 CTCCACCTGCACTCCAGCCTGGG - Intergenic
1164895898 19:31877390-31877412 CACCACCTGCACTCCAGTCTGGG + Intergenic
1165031266 19:32999557-32999579 GTCCCCCTGCACCCAGATGTGGG - Intronic
1165430199 19:35767775-35767797 CTCCATCTGAATCCCAGTGTCGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165755607 19:38291069-38291091 CTCCACCTGTTTCCCGGTGAAGG + Intronic
1166270784 19:41712175-41712197 CTCCATCTTCATCCTGGTGTGGG + Intronic
1166375305 19:42324273-42324295 CTCCACCTGCTTCCCGGCCTGGG - Intronic
1167618447 19:50548724-50548746 CTCCACCGGCCCCCAGGGGTGGG + Exonic
1168659960 19:58157719-58157741 CTCCACCTGCGGCCCTGTGCGGG + Intergenic
925194236 2:1910420-1910442 CTCCACCTGCATCAGGGTCTTGG - Intronic
926035049 2:9630158-9630180 ATCCATCTGCACCACGGTGCTGG - Exonic
926474701 2:13308258-13308280 CTCCACCTGCAGCCCGGGTCTGG - Intergenic
928493137 2:31804052-31804074 CTCCACCTGCAGCCCCGGGCGGG + Intergenic
930338697 2:50084186-50084208 CTCCATCTGCCGCCCCGTGTGGG - Intronic
930485583 2:52007220-52007242 CTCCACCTGCAGCCCCGGTTTGG + Intergenic
933553339 2:83802799-83802821 CTCCACCAGCACCACAGTGTGGG + Intergenic
933660716 2:84925413-84925435 CTCCACCTGCCCACAGGTTTAGG + Intergenic
934639869 2:96021412-96021434 CCCCACCTCCACCCAGGTGTCGG + Intergenic
941929321 2:170924639-170924661 CTGCAGCTGCACCCAGGAGTTGG + Intergenic
944843073 2:203642814-203642836 CTCCATCTGCGCCCTGGTGCGGG - Intergenic
947745180 2:232503583-232503605 CTGCACCTGCCCCTCGGGGTGGG + Intergenic
948484725 2:238273103-238273125 CTCCATCTCCTCCACGGTGTAGG + Exonic
948897815 2:240935341-240935363 CTCCAGCTGCCACCAGGTGTCGG - Intronic
1171189521 20:23149366-23149388 CTGCACCTCCACACAGGTGTTGG - Intergenic
1176081075 20:63273200-63273222 CTCCACCCGCACCCCGGATCTGG + Intronic
1176309332 21:5141497-5141519 CTCCACCTTCACCTCTGCGTGGG + Intronic
1176790203 21:13311149-13311171 CTGCAGCTGCACCCGGGAGTGGG + Intergenic
1178074244 21:29000551-29000573 CTCCACCTGCAACCCGGGTACGG + Intergenic
1179529973 21:42011367-42011389 CTCCACCTGCGACCCGGGCTGGG - Intergenic
1179661471 21:42878818-42878840 CTCCACGTGCACCCTTGGGTTGG + Intronic
1179723650 21:43329995-43330017 CTCCAGCTGCACCCTGGAGGGGG - Intergenic
1179847730 21:44120536-44120558 CTCCACCTTCACCTCTGCGTGGG - Intronic
1179962944 21:44781007-44781029 CTTCAGCTGCACGCAGGTGTTGG + Intronic
1180130068 21:45821477-45821499 TTCCCCCTGCACCACGCTGTGGG + Intronic
1180149360 21:45939858-45939880 CACCACCTGCAGGCAGGTGTGGG + Intronic
1180189186 21:46154553-46154575 CACCACCTGCAGCCCCTTGTGGG - Intronic
1183096201 22:35553786-35553808 CTGCACCTGCACCCCAGCCTTGG + Exonic
1183492597 22:38124603-38124625 CTCCACCTGCTTCCTGGTGGAGG + Intronic
1184525246 22:45018982-45019004 CTCTACCTGAACCCAGGTCTGGG + Intergenic
949675390 3:6447613-6447635 CTCCACCTGGACACTGCTGTAGG - Intergenic
949770071 3:7569005-7569027 CTCCACCTGCGCCCCTGTGTGGG + Intronic
950068888 3:10136384-10136406 CTCCACCTGCGCCCCGGTGCAGG - Intergenic
950524017 3:13513146-13513168 CTCCACTTGCACCCCTTTGAGGG - Intergenic
950584049 3:13880266-13880288 TGCCACCTGCACCCCGGAGCAGG - Intergenic
951951014 3:28200362-28200384 CTCCACCTGCACGCCCCGGTGGG - Intergenic
953331093 3:42053524-42053546 TTCCTCCTGGACCCTGGTGTAGG + Intronic
953425664 3:42795461-42795483 ATCCACCTGCCTCCCAGTGTTGG + Intronic
955266389 3:57449294-57449316 CTCCACCTGCAGCCCGGGTGTGG - Intronic
960199338 3:114812645-114812667 CTCCACCTGCAGCCCGGGTGCGG - Intronic
960227462 3:115184836-115184858 CTCCACCTGCAGCCCGGTGCGGG - Intergenic
961357467 3:126348102-126348124 CTCCCTCTGCACCCCGGTGTTGG - Intronic
961426024 3:126848954-126848976 CTACACCTGCACCTCAGTGCAGG + Intronic
961457496 3:127031396-127031418 ATCCACCTGACCCCAGGTGTGGG - Intronic
961746649 3:129068255-129068277 CTCCACCTGGGCCCCCGTGCGGG - Intergenic
965003593 3:162987732-162987754 CTCCACCTGCGGCCAGGTGCAGG + Intergenic
965044065 3:163552270-163552292 TTCCACCTACACCCCTGTGCGGG - Intergenic
965256851 3:166424345-166424367 CTCCACCTGCAGCCTGGTGCGGG + Intergenic
966850751 3:184163748-184163770 ATCCACCTGCATCCCTGTGCTGG + Intronic
967268470 3:187713188-187713210 CACCACCTGCATCACAGTGTAGG - Intronic
968494354 4:907231-907253 CCCCACCTGCACCCAGCTGAGGG + Intronic
969243386 4:5916613-5916635 AACCACCTGCACCCCTGTCTGGG - Intronic
969303078 4:6308982-6309004 CTCCACCTGCAGCCCGGTTGGGG - Intergenic
970171935 4:13299096-13299118 CTCGCCCTGCACCCGGGTGTGGG - Intergenic
971852178 4:31996830-31996852 CTCCACCTGCAGTCCGGTGGGGG + Intergenic
972454692 4:39242107-39242129 CTTCCACTGCACCCCAGTGTGGG - Intronic
973765023 4:54155072-54155094 CTCCACCTGCGGCCTGGTGCAGG - Intronic
973878186 4:55241868-55241890 CTCCACCTGCGGCCCAGTGTGGG + Intergenic
974792696 4:66712365-66712387 TTCCACCTGCGCCCCAGTGCGGG - Intergenic
975330210 4:73104365-73104387 CTCCACGTGGACCCCAGTGAAGG + Intronic
975439875 4:74399012-74399034 CTCCACCTGCGGCCCGGTGGGGG - Intergenic
975754924 4:77562354-77562376 CTCCACCTGCACCGGGGTGCAGG + Intronic
977717278 4:100196468-100196490 CTCCACCTGCAGCCCTGGTTCGG - Intergenic
977885697 4:102250244-102250266 CTCCACCTGCGCCCCGGTGCAGG - Intergenic
979857443 4:125651711-125651733 CTCCACCTGCACCCCCGGTGTGG - Intergenic
980824042 4:138052893-138052915 CTCCACCTGCAGCCCCCTGCGGG - Intergenic
982488603 4:155999896-155999918 CTGAACCCGCGCCCCGGTGTGGG - Intergenic
982863463 4:160482181-160482203 CTCCACCTGTGCCCCGGTGCAGG + Intergenic
982921343 4:161277640-161277662 CTCCACCTGCAGCCCGGTGCGGG + Intergenic
983552986 4:169035784-169035806 CTCCACCTGCAGCCCGGATGTGG - Intergenic
985409103 4:189664687-189664709 CTCCACCTGCGGCCAGGTGCGGG - Intergenic
985591431 5:767330-767352 CTTCAGCTGCGCCCTGGTGTGGG - Intergenic
986152076 5:5138198-5138220 CTCCACCTGCGCCCCGGTGCGGG + Intergenic
986174961 5:5344174-5344196 CTCCAGCTGCACCTCTGTGGAGG - Intergenic
986698068 5:10375569-10375591 CTCCACCTGCAGCCCGGGTGCGG + Intronic
986993344 5:13578883-13578905 CTCCACCTGCAGCCCGGTGCCGG + Intergenic
987352228 5:17032422-17032444 CTCCACCTGCGCCCCGGTGCAGG - Intergenic
987476612 5:18399608-18399630 CTCCACCTGCAGCCCCGTGCGGG - Intergenic
988142997 5:27267199-27267221 CTCCGCCTGCACCCCGGCTGGGG - Intergenic
988287605 5:29240372-29240394 CTCCTCCTGCACCCACGTCTAGG - Intergenic
989950644 5:50293261-50293283 CTCCACCTGCACCGGGGTGTGGG + Intergenic
990243310 5:53837341-53837363 CTCCACCTGCGCCCCCCTGCGGG + Intergenic
990512071 5:56498607-56498629 CTCCACCTGCGGCCTGGTGCGGG - Intergenic
990665644 5:58069086-58069108 CTCCGTCTGTGCCCCGGTGTGGG - Intergenic
990869541 5:60415828-60415850 CTCCACCTGCCGCCCGGTGCGGG + Intronic
995744696 5:115391555-115391577 CTCCTCCTCCACCCTGGTGATGG + Intergenic
996530472 5:124522036-124522058 CTCCACCTGCGCCCCCGTGCGGG + Intergenic
996815637 5:127569825-127569847 CTCCACCTGCGGCCAGGTGCCGG + Intergenic
997375576 5:133394763-133394785 CTCCACCTGCAGCCCGGTGAGGG + Intronic
997694505 5:135850567-135850589 CCCCACCTGCATGCTGGTGTGGG - Intronic
998406352 5:141876720-141876742 CTCCGCCTGGTCCCCGCTGTAGG - Intronic
999287847 5:150404872-150404894 CTGCAGCTGGACCCGGGTGTTGG - Intronic
1000889257 5:166784489-166784511 CTCCACCTGCAGCCTGGTCCCGG - Intergenic
1001841617 5:174881084-174881106 CTCCACCTGAGCCCAGGTGCGGG + Intergenic
1001848959 5:174946296-174946318 CTCCACCTGTACCCCAGGGCTGG + Intergenic
1002437341 5:179239701-179239723 CTCCCTCTGCACCCCTCTGTGGG - Intronic
1002455941 5:179345396-179345418 CTCCAGCTGCCCCCAGATGTGGG - Exonic
1002596935 5:180329851-180329873 CTCCACCTCCTCCTCAGTGTAGG + Intronic
1002788006 6:419027-419049 CCCCACCAGCACCCCCATGTGGG + Intergenic
1003126095 6:3356897-3356919 CACCACCTGCATCACAGTGTCGG - Intronic
1003947348 6:11087628-11087650 CTCCACCTGCAGCGCTGTGCGGG + Intergenic
1003956750 6:11171477-11171499 CTCCACCTGCGGCCCCGTGCGGG + Intergenic
1004497709 6:16180681-16180703 CTCCACCTGTGGCCCCGTGTAGG - Intergenic
1004883767 6:20032723-20032745 CTCCACCTGCGGCCCGGTGTGGG + Intergenic
1005059364 6:21761575-21761597 CTCCACCTGTGGCCCGGTGCGGG + Intergenic
1005440750 6:25865250-25865272 ATCCACGTGCACCCAGCTGTAGG + Intronic
1008038864 6:46775011-46775033 CTCAACCTGCAGCCCCGTGCGGG + Intergenic
1008230755 6:48983378-48983400 CTCCACCTGCGGCCCTGTGTGGG - Intergenic
1008230963 6:48984317-48984339 CTCCACCTGCGGCCCTGTGCGGG + Intergenic
1009685413 6:66949628-66949650 CTCCACCTGCAGCCCCGTGCGGG + Intergenic
1011870013 6:91881841-91881863 CTCCACCTGCAGCCCGGGTGCGG - Intergenic
1011879862 6:92011697-92011719 CTCCACCTGCAGCCCAGTGCGGG - Intergenic
1013174997 6:107669247-107669269 CCCCACCTCCACACCGCTGTAGG + Intergenic
1016392960 6:143593002-143593024 CTGCACCTGCACTCCGGCCTGGG + Intronic
1016482242 6:144495097-144495119 CTCCACCTGCAGCCCGGGTGCGG - Intronic
1018545740 6:164933710-164933732 CTCCACCTGCAGCCCGGGTGCGG + Intergenic
1018876787 6:167827616-167827638 CTCCACCTGCAGCCCGGTTGTGG + Intronic
1018910972 6:168100919-168100941 CCCCACCCTCACCCTGGTGTGGG - Intergenic
1018967055 6:168497358-168497380 CTGCACCTGCCCCCAGGCGTGGG + Intronic
1019332201 7:465911-465933 GTCCACCTGCACCCCAGCCTGGG + Intergenic
1019635871 7:2075282-2075304 CTCTACCTGCACGCCTGGGTGGG - Intronic
1020055993 7:5117795-5117817 GACCACCAGCACCCGGGTGTAGG - Intergenic
1020552207 7:9621430-9621452 CTCCACCTGCGGGCCGGTGCCGG - Intergenic
1022895559 7:34747395-34747417 CTGCACCTGCAGCCTGGTGCAGG + Intronic
1023024161 7:36035899-36035921 CTCAACATGGACCCCGTTGTTGG + Intergenic
1026187022 7:68090361-68090383 CTCCACCTGCAGCCCCGTTGTGG - Intergenic
1026933387 7:74237814-74237836 TCCCACCTCCACCCCGGAGTAGG + Intronic
1028303229 7:89228715-89228737 CTCCACCTGCACCCCGGTGTGGG - Intronic
1030102064 7:105955757-105955779 CTCCACCTGCGGCCGGGTGCTGG - Intronic
1035108436 7:156460999-156461021 CTCCACCTGCACCCTGATCTGGG - Intergenic
1035463825 7:159063093-159063115 CTCCGCCTGCGGCCCGGTGCAGG - Intronic
1035482939 7:159202001-159202023 CTCCACCTGCACCCCACTGCTGG - Intergenic
1037764534 8:21764207-21764229 ATCCACCAGCACCTCGATGTTGG - Intronic
1038478580 8:27886150-27886172 CTCCACCCAGACCCCAGTGTCGG + Intronic
1040109796 8:43562221-43562243 CTCCTCATGCACGCCGGTTTGGG + Intergenic
1042867273 8:73366894-73366916 CTGCCCAAGCACCCCGGTGTCGG + Intergenic
1043346530 8:79303907-79303929 CTCCACCTGCAGCCCGGGAGCGG + Intergenic
1044853633 8:96452691-96452713 CTCCACCTGCAGCCCAGTATGGG + Intergenic
1045743280 8:105387279-105387301 CTCCACCTGCGCCCCAATGCGGG - Intronic
1046149275 8:110202523-110202545 CTCCACCTGCGGCCCGGTGCGGG - Intergenic
1047124830 8:121948490-121948512 CTCCACCTGCGCCCCAGTGCGGG + Intergenic
1047995119 8:130327346-130327368 CTCCAACTGGACCTCAGTGTAGG + Intronic
1048073336 8:131042354-131042376 CTCCACCTGCATCCGGCTGCGGG - Exonic
1048676893 8:136793753-136793775 CTCCACCTGCTGACCGGTGCGGG - Intergenic
1049792630 8:144478985-144479007 CTCCACCTCCACCCCCAGGTAGG - Intronic
1051305017 9:15699992-15700014 CTCCACCTGCAGCCCGGGTGCGG - Intronic
1051383377 9:16480920-16480942 CTCCACCTGCAGCCTGGTGCGGG + Intronic
1051419660 9:16877068-16877090 CTCCACCTGCAGCCCAGTGCGGG - Intergenic
1052576645 9:30299677-30299699 CTCCACCTGCACCCCAGTGTGGG + Intergenic
1053841559 9:42191892-42191914 TGCCCCCTGCACCCCGGTGCCGG - Intergenic
1054120021 9:61198286-61198308 TGCCCCCTGCACCCCGGTGCCGG - Intergenic
1054587735 9:66984276-66984298 TGCCCCCTGCACCCCGGTGCCGG + Intergenic
1055597095 9:77876348-77876370 CTCCAACTGCATCCCTGTCTGGG + Intronic
1056080889 9:83093246-83093268 CTCCACCTGCAGCCTGGTGCGGG - Intergenic
1056216349 9:84408893-84408915 CTCCACCTGCCGCCCCGTGCAGG + Intergenic
1056677184 9:88685872-88685894 CTCCACCTGCGGCCTGGTGAGGG - Intergenic
1056690871 9:88807676-88807698 CTTCACCTGCCCACAGGTGTTGG - Intergenic
1057118239 9:92545658-92545680 CTCCACCTGCAGCCTGGTGCGGG + Intronic
1058379501 9:104362850-104362872 CTCCACCTGCGGCCCAGTGTGGG - Intergenic
1059361276 9:113743739-113743761 CTGCACCTGCACACTGGGGTTGG - Intergenic
1060091412 9:120746757-120746779 CTCCACCTGCAGCCCGGGTGCGG + Intergenic
1060977958 9:127776519-127776541 CTCCCCCTGCCCCCAGCTGTGGG + Intronic
1062017147 9:134296685-134296707 CTCCAGCTGCACCTCGGGGGAGG - Intergenic
1062121755 9:134837597-134837619 CTCCACCTGCATCCTGGGATAGG + Intronic
1062189458 9:135240374-135240396 CTCCACCTGCTTCCTGGTGCTGG - Intergenic
1185747676 X:2584880-2584902 CTCACCCTGCACCCCGGTATGGG + Intergenic
1188881905 X:35499691-35499713 CTCTACCTGCGGCCCGGTGCAGG + Intergenic
1190330198 X:49230978-49231000 CTCCACCTGCTCCTGGGGGTGGG + Exonic
1193708902 X:84856593-84856615 CTCCACCTGCGGCCCGGTGCAGG - Intergenic
1194965625 X:100285554-100285576 CTCAAGCTCCACCCAGGTGTAGG + Intergenic
1195460206 X:105115698-105115720 CTCCACCTGCGGCCCAGTGCGGG - Intronic
1196616173 X:117769306-117769328 CCCCCCCTGCCCCCCGCTGTGGG + Intergenic
1199737444 X:150696878-150696900 CTCCACCTGCTCCCACTTGTAGG - Intronic
1199832871 X:151562610-151562632 CTCCACCTGCGGCCCCCTGTGGG - Intergenic
1202202359 Y:22367098-22367120 CTCCACTTGCGGCCGGGTGTGGG - Intronic