ID: 1028304149

View in Genome Browser
Species Human (GRCh38)
Location 7:89241145-89241167
Sequence ACGTAGAAGAGATATGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028304147_1028304149 -10 Left 1028304147 7:89241132-89241154 CCATTCTGCTCTTACGTAGAAGA 0: 1
1: 0
2: 0
3: 12
4: 201
Right 1028304149 7:89241145-89241167 ACGTAGAAGAGATATGAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 158
1028304145_1028304149 7 Left 1028304145 7:89241115-89241137 CCTAAAACCACTGAAGGCCATTC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1028304149 7:89241145-89241167 ACGTAGAAGAGATATGAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 158
1028304146_1028304149 0 Left 1028304146 7:89241122-89241144 CCACTGAAGGCCATTCTGCTCTT 0: 1
1: 0
2: 2
3: 36
4: 242
Right 1028304149 7:89241145-89241167 ACGTAGAAGAGATATGAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028304149 Original CRISPR ACGTAGAAGAGATATGAGGC TGG Intronic
900673335 1:3869355-3869377 ACTTAGATGAGATAACAGGCTGG - Intronic
900847209 1:5113486-5113508 AAGGAAAAGAGATAGGAGGCTGG + Intergenic
903546881 1:24129983-24130005 AAATGGAAGAGATATCAGGCTGG - Intronic
905162776 1:36051229-36051251 ATGTAAAAGATATTTGAGGCCGG - Intronic
905302271 1:36993595-36993617 ACGGTGAAGTGATGTGAGGCTGG + Intronic
907112773 1:51941404-51941426 AAGGAGAAGAGATAGGAGGCAGG + Intronic
910668979 1:89753914-89753936 AGGGAGAAGAGCTAAGAGGCTGG + Intronic
910707298 1:90143375-90143397 ATCTAAAAGAGATATGAGGCTGG - Intergenic
911250889 1:95575188-95575210 ACGGAGAGATGATATGAGGCTGG + Intergenic
911490332 1:98557403-98557425 ACGTAGAAAAGATATGGAGAAGG - Intergenic
915335352 1:155137743-155137765 AGGTAGGAGAGATAAGAGTCAGG + Intronic
915822670 1:159042070-159042092 AGGTAGAAGACATATGATCCTGG - Intronic
917383412 1:174440179-174440201 ACATAGAAGAGAAGTGAGACTGG + Intronic
917662114 1:177187032-177187054 ACTTAGAAAAGGTATGAGGAGGG + Intronic
918988856 1:191671152-191671174 AAGTAGAAGTGAAATGAGGTTGG + Intergenic
920535927 1:206736540-206736562 GAGGAGAGGAGATATGAGGCTGG + Intergenic
920852640 1:209638893-209638915 ACGGAGAAGAGGTACGAGGTGGG + Intronic
921170469 1:212543035-212543057 ACCAAGAAGAGAAATGAAGCAGG - Intergenic
922444979 1:225689524-225689546 AGGTCAAAGAGAAATGAGGCAGG - Intergenic
923419316 1:233797165-233797187 ATGCAGAAGAGTTATGTGGCAGG - Intergenic
923843682 1:237704114-237704136 AGGTAGAAGCTATATGAGGTAGG + Intronic
924178853 1:241420778-241420800 GTGAAGAAGATATATGAGGCTGG - Intergenic
1065061975 10:21911179-21911201 ACGTGGAAGAGCTATGAGGAAGG + Intronic
1069549930 10:69356586-69356608 ACATAAAAGACAAATGAGGCCGG + Intronic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1081310156 11:41560859-41560881 ATTTAAAAGAGAGATGAGGCTGG - Intergenic
1081800182 11:45853350-45853372 AGGAAGCAGAGATGTGAGGCTGG - Intronic
1084837966 11:71818445-71818467 ATGGAGATGAGATATCAGGCAGG + Intergenic
1085750348 11:79155758-79155780 AGGAAGAAGAGAAAGGAGGCAGG - Intronic
1088287006 11:108199902-108199924 ATGAAGAAGAGATAGGAGCCAGG - Intronic
1088738138 11:112745536-112745558 AAGCAGAAGAGATAAGAGGCAGG + Intergenic
1088788817 11:113206022-113206044 GACTAGAAGAGATAAGAGGCAGG - Exonic
1089096648 11:115925213-115925235 ACATAGGTCAGATATGAGGCAGG + Intergenic
1089175006 11:116542052-116542074 ACTTAGTAGAGATAAGAGACAGG + Intergenic
1090236266 11:125150033-125150055 ATGTTGAAGAGATAGGAGGAGGG - Intergenic
1092400739 12:8175628-8175650 ATGGAGATGAGATATCAGGCAGG - Intronic
1098336892 12:69413553-69413575 ACTAAGTAAAGATATGAGGCTGG + Intergenic
1100376553 12:94021348-94021370 AGATAGAAGAGAAATGTGGCCGG - Intergenic
1100622887 12:96297175-96297197 CTGAAGAAGAGTTATGAGGCTGG + Intronic
1101976125 12:109360425-109360447 ACAGAGAAGAGAGATGGGGCAGG - Intronic
1104189214 12:126462390-126462412 TATTAGAAGTGATATGAGGCAGG + Intergenic
1106796617 13:33212956-33212978 ACGTAGCAGAGATAAGGGGTAGG - Intronic
1107522345 13:41195582-41195604 AAGTATTAGAGATTTGAGGCAGG + Intergenic
1110409228 13:75185547-75185569 ACATAGAAGTGATATGATGATGG - Intergenic
1113005946 13:105702085-105702107 ACGTACAAGAGATAAGAGTCAGG - Intergenic
1114864864 14:26577819-26577841 ACATAGAAGTGATATAAAGCAGG + Intronic
1115022354 14:28697863-28697885 AAGGAGAACAGATATGAGGCGGG - Intergenic
1115569351 14:34652304-34652326 AGGAAGAGGAGATATCAGGCTGG - Intergenic
1116742511 14:48775186-48775208 ACATAGAAGAAATGTGAGGAGGG + Intergenic
1121192773 14:92044749-92044771 AGGAAGAAGAGAGATTAGGCTGG + Exonic
1121389491 14:93562098-93562120 AGGAAGAAGAGAGATTAGGCTGG + Intronic
1122711273 14:103660141-103660163 ACCTAGAGGAGATGTGAGGGAGG - Intronic
1123476159 15:20593654-20593676 ACATAGCAGAGAGATGGGGCTGG - Intergenic
1123641853 15:22406710-22406732 ACATAGCAGAGAGATGGGGCTGG + Intergenic
1126352694 15:47761617-47761639 ACGTTGAATAGATATGACACTGG + Intronic
1128771510 15:70286159-70286181 TGGGAGAAGTGATATGAGGCTGG - Intergenic
1130975274 15:88769125-88769147 ATGAAGAAGATATTTGAGGCCGG + Intergenic
1131457596 15:92595341-92595363 AAGATGAAGAGAGATGAGGCAGG - Intergenic
1133616986 16:7486431-7486453 ACGTAGAAAAGACACAAGGCCGG - Intronic
1135415409 16:22264949-22264971 AGGCAGCAGAGATATGAGACAGG - Intronic
1135717303 16:24782579-24782601 ACGTAAGAGTGATTTGAGGCCGG + Intronic
1135791502 16:25400805-25400827 AGATAGAAGAAACATGAGGCAGG - Intergenic
1138013312 16:53404852-53404874 ATTAAGAAGAGAAATGAGGCCGG - Intergenic
1138275758 16:55733177-55733199 AGGTAGCAGAGATAAGAGACTGG + Intergenic
1144284334 17:13758245-13758267 ATGAAGAAGACATCTGAGGCTGG - Intergenic
1145102975 17:20092066-20092088 AAGTAGAAGAGAAAGGAGGGAGG - Intronic
1149070645 17:52538098-52538120 ATTTAGAAGACATATGTGGCAGG + Intergenic
1151257610 17:72891131-72891153 AGATAAAAGACATATGAGGCTGG + Intronic
1153778260 18:8472678-8472700 AAGTAGGAAAGATAAGAGGCTGG + Intergenic
1156630048 18:38956341-38956363 ACATAGCAGAGATAAAAGGCAGG - Intergenic
1158287322 18:55898477-55898499 ATCTTGAAGAGACATGAGGCTGG + Intergenic
1158916532 18:62137164-62137186 GCGCAGGAGAAATATGAGGCTGG - Intronic
1159072652 18:63643216-63643238 ACCTGGAAGAGACATGAAGCGGG + Exonic
1159074095 18:63660855-63660877 ACCTGGAAGAGACATGAAGCGGG + Exonic
1159461376 18:68725621-68725643 AAGTTGAAGAGATTTGAAGCAGG - Intronic
1162287357 19:9749107-9749129 AGGAAGAAGAGAGATCAGGCTGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1167687825 19:50967806-50967828 ACATAGAAGAGGTAGGAGGTAGG - Intronic
1167786633 19:51643212-51643234 AAGTAGAAGGGGTATGGGGCAGG + Exonic
926337047 2:11871607-11871629 AAGTAAAACAGATCTGAGGCCGG - Intergenic
926405020 2:12542544-12542566 ACGTAGAAGAGATGTTCTGCGGG + Intergenic
928334295 2:30382929-30382951 AGGGAGAAGAGATGGGAGGCAGG - Intergenic
928385481 2:30863942-30863964 ATGGAGCAGAAATATGAGGCAGG + Intergenic
929014154 2:37477414-37477436 GTGTAGAAGAAATCTGAGGCTGG + Intergenic
930350064 2:50240382-50240404 ATGTAGAAGAGAGCTGAGGAAGG - Intronic
936653315 2:114455221-114455243 AGTTAGAAGAGATAAGAGGTGGG + Intronic
938709186 2:133960733-133960755 AAGTAAAAGAAACATGAGGCCGG - Intergenic
941283587 2:163581970-163581992 AGGAAGAAAACATATGAGGCTGG + Intergenic
944353547 2:198758423-198758445 TCTTAGAAGACATATGCGGCCGG - Intergenic
946531230 2:220572464-220572486 ATGTTGATGAGAAATGAGGCTGG + Intergenic
1172685678 20:36752348-36752370 AGGTAGAAGAGTTTTGAGGCTGG - Exonic
1173365606 20:42381940-42381962 AGGTGGCAGAGAAATGAGGCAGG + Intronic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1178465174 21:32841374-32841396 ACAAAGAAGAGTTTTGAGGCTGG - Intergenic
1181776075 22:25161008-25161030 AACTAGATGGGATATGAGGCTGG - Intronic
1183941823 22:41300157-41300179 AACTTGAAGAGATAAGAGGCTGG + Intergenic
1184605333 22:45570032-45570054 ACATAGAAGAAAAATGGGGCCGG + Intronic
950404612 3:12796890-12796912 AGGGAGAAGAGAGAAGAGGCAGG - Intronic
954161163 3:48723672-48723694 AGGAAGAAGAGAGATCAGGCTGG + Intronic
954418044 3:50403700-50403722 TGGTAGAAGAGAGATGAGGTTGG - Intronic
957758331 3:84522387-84522409 ATGTAGCAGTGATATGAGACGGG + Intergenic
959236675 3:103731677-103731699 AGGTAAAAGAGATATGATGATGG - Intergenic
959284384 3:104389755-104389777 ACATAGAATACATATGAGGAGGG + Intergenic
960741461 3:120838194-120838216 AAATAAAATAGATATGAGGCCGG - Intergenic
963104348 3:141633244-141633266 ACCAATAAGAGATAGGAGGCAGG + Intergenic
963251550 3:143108790-143108812 AGGTAGACAAGGTATGAGGCCGG - Intergenic
965335630 3:167428493-167428515 AGGAAGAAGAGAAATTAGGCTGG - Intergenic
968081841 3:195851926-195851948 TTGTACAAGAGATAAGAGGCTGG - Intergenic
968412505 4:402276-402298 AGGAAGAGGAGATATCAGGCTGG + Intergenic
969779382 4:9385950-9385972 ATGGAGATGAGATATCAGGCAGG + Intronic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
973255315 4:48105756-48105778 ACTCAGGAGAGAGATGAGGCGGG - Intronic
975098722 4:70487706-70487728 ACCTAAAAGAGAAATGAGACGGG + Intergenic
975100673 4:70509397-70509419 AAGGAGAAGAGATCTGAGGAGGG + Intergenic
975662956 4:76705603-76705625 AAGTAGAAGAAATATGTGGGTGG + Intronic
975917018 4:79337473-79337495 AATTACAAGAGATAAGAGGCCGG + Intergenic
979566157 4:122156307-122156329 AAATAGAAGAGAAATGAGGTTGG + Intronic
979933271 4:126659200-126659222 ACTTAGAAATGATATGAGTCAGG - Intergenic
980556934 4:134419806-134419828 ATGTAGAGTAGATATGAGGGGGG - Intergenic
981116396 4:140995652-140995674 ATGGAGATGAGATAGGAGGCGGG - Intronic
984537196 4:180991154-180991176 AAGAAGAAGAGATAAGAGGTAGG + Intergenic
984809485 4:183782208-183782230 AGGCAGAAGAGAGATGTGGCAGG - Intergenic
984915349 4:184718494-184718516 ACGTAGGAGTGAGATGAGACTGG + Intronic
986564261 5:9095451-9095473 ACGTAGAAGAGATCTGAACTAGG + Intronic
989077443 5:37578880-37578902 ATGTGGAAGAGATATGGGTCAGG - Intronic
989343072 5:40398603-40398625 ACATAGAACATATATTAGGCCGG - Intergenic
990073690 5:51816641-51816663 GGGCAGAGGAGATATGAGGCAGG - Intergenic
993290579 5:86063044-86063066 AGGTAGAAGAAATGTGAGGAAGG - Intergenic
994133657 5:96260798-96260820 ACACGGAAGAGCTATGAGGCAGG - Intergenic
995567655 5:113448305-113448327 ATGTGGAAGAGCTATGAGTCTGG + Intronic
996430168 5:123366712-123366734 AGATAGAATAGATTTGAGGCTGG - Intronic
1000607361 5:163339079-163339101 AGGAAGAAGAGAGATCAGGCTGG - Intergenic
1004401706 6:15294658-15294680 ACATGGAAGGGAGATGAGGCTGG + Intronic
1005200291 6:23336864-23336886 ACATAGAAGGGACAAGAGGCAGG + Intergenic
1006932004 6:37694214-37694236 CCCTAGAAGAGAGAAGAGGCTGG - Intronic
1008208026 6:48686850-48686872 AAGTAGAAGAGCTATGATGCAGG - Intergenic
1009801626 6:68545083-68545105 ACATAGTAGATATATGAGGTTGG - Intergenic
1012390129 6:98728948-98728970 AAGTAAAAGAAATATGAGGTAGG - Intergenic
1013841887 6:114406219-114406241 AAAAAGAAGAGATAGGAGGCAGG + Intergenic
1018870543 6:167779073-167779095 ACGTAGACTAGACATGAGGCGGG + Intergenic
1020888329 7:13847652-13847674 AGGTAGAAGAGAATTCAGGCTGG - Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1026514816 7:71059672-71059694 ACTTAGAACAGAGATGAGGCGGG - Intergenic
1027697385 7:81428960-81428982 ACCTAGAGGAGATAGGAAGCAGG - Intergenic
1028304149 7:89241145-89241167 ACGTAGAAGAGATATGAGGCTGG + Intronic
1028629043 7:92913534-92913556 ACGTGGAAGAAAGATGAGGGGGG + Intergenic
1029423890 7:100485126-100485148 ACGGAGAAGAGACATGACTCGGG - Intronic
1031081615 7:117263779-117263801 AGGTAGAAGAGATAAGTGGGAGG - Intergenic
1036276816 8:7359910-7359932 ATGGAGATGAGATATCAGGCAGG + Intronic
1038293252 8:26268502-26268524 ATGTAGTAGAGATACTAGGCAGG - Intergenic
1038666697 8:29543620-29543642 GCCTAGAAGAGAGATGAGGGAGG + Intergenic
1042731892 8:71944794-71944816 ACCTAGAAGAGAGAAAAGGCAGG - Intronic
1043197673 8:77318952-77318974 CAGTAGAAGAGATATGAAGCTGG - Intergenic
1044020325 8:87098140-87098162 ACGTGGAAGGCATATGATGCTGG + Intronic
1048882993 8:138885514-138885536 AGGTAGGAGGGATTTGAGGCAGG - Intronic
1048917752 8:139200873-139200895 ACATAGAGGAGAAATGAGTCAGG + Intergenic
1051449643 9:17181140-17181162 AGGTAGAAGAGAAAGAAGGCAGG - Intronic
1055664890 9:78543497-78543519 AGGGAGAAGAGAAATGAAGCGGG - Intergenic
1059448340 9:114353558-114353580 ACTTAAAACAGAAATGAGGCTGG - Intronic
1189058542 X:37727180-37727202 TGGAAGAAGAGAAATGAGGCAGG + Intronic
1189376001 X:40466781-40466803 AAGAAGATGAGATTTGAGGCTGG - Intergenic
1190861291 X:54347008-54347030 ATGTAGAAGAGATATTATCCTGG - Intronic
1192601620 X:72470402-72470424 AGGTAGAAGAAATATGATGGAGG - Intronic
1194675748 X:96791673-96791695 AAGTAGAAGAGGGATGATGCTGG + Intronic
1198620051 X:138497659-138497681 AGGTAGAATAGATTGGAGGCAGG + Intergenic
1200015169 X:153156007-153156029 ACTTAGAAAAGAAATGGGGCCGG + Intergenic
1200322753 X:155206815-155206837 ACTCAAAAGAGATATGAGGTAGG - Intronic
1200884754 Y:8256224-8256246 CTTTAGAACAGATATGAGGCAGG + Intergenic
1200953783 Y:8925634-8925656 CTTTAAAAGAGATATGAGGCAGG - Intergenic
1201057937 Y:10014618-10014640 TTTTAAAAGAGATATGAGGCAGG + Intergenic