ID: 1028313441

View in Genome Browser
Species Human (GRCh38)
Location 7:89368728-89368750
Sequence GGAGAGAAAAATCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028313441_1028313443 10 Left 1028313441 7:89368728-89368750 CCTCTCTGCAGATTTTTCTCTCC No data
Right 1028313443 7:89368761-89368783 CTCATGAGATCTCGTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028313441 Original CRISPR GGAGAGAAAAATCTGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr