ID: 1028318701

View in Genome Browser
Species Human (GRCh38)
Location 7:89435355-89435377
Sequence AGTTTTTAAGAGCTGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028318701_1028318704 -1 Left 1028318701 7:89435355-89435377 CCCTACTCCAGCTCTTAAAAACT No data
Right 1028318704 7:89435377-89435399 TTACATACATTGTCCCACCATGG No data
1028318701_1028318710 26 Left 1028318701 7:89435355-89435377 CCCTACTCCAGCTCTTAAAAACT No data
Right 1028318710 7:89435404-89435426 CAATCTCAAAGGTATTACTAAGG No data
1028318701_1028318707 15 Left 1028318701 7:89435355-89435377 CCCTACTCCAGCTCTTAAAAACT No data
Right 1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028318701 Original CRISPR AGTTTTTAAGAGCTGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr