ID: 1028318707

View in Genome Browser
Species Human (GRCh38)
Location 7:89435393-89435415
Sequence ACCATGGCTGCCAATCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028318703_1028318707 8 Left 1028318703 7:89435362-89435384 CCAGCTCTTAAAAACTTACATAC No data
Right 1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG No data
1028318701_1028318707 15 Left 1028318701 7:89435355-89435377 CCCTACTCCAGCTCTTAAAAACT No data
Right 1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG No data
1028318702_1028318707 14 Left 1028318702 7:89435356-89435378 CCTACTCCAGCTCTTAAAAACTT No data
Right 1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG No data
1028318698_1028318707 27 Left 1028318698 7:89435343-89435365 CCACTTAGTGCCCCCTACTCCAG No data
Right 1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG No data
1028318699_1028318707 17 Left 1028318699 7:89435353-89435375 CCCCCTACTCCAGCTCTTAAAAA No data
Right 1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG No data
1028318700_1028318707 16 Left 1028318700 7:89435354-89435376 CCCCTACTCCAGCTCTTAAAAAC No data
Right 1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028318707 Original CRISPR ACCATGGCTGCCAATCTCAA AGG Intergenic
No off target data available for this crispr