ID: 1028325102

View in Genome Browser
Species Human (GRCh38)
Location 7:89513982-89514004
Sequence ACTTATAAGCTACAGTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028325102_1028325108 5 Left 1028325102 7:89513982-89514004 CCACCTGACTGTAGCTTATAAGT No data
Right 1028325108 7:89514010-89514032 TTTGGGGATTTAATAACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028325102 Original CRISPR ACTTATAAGCTACAGTCAGG TGG (reversed) Intergenic
No off target data available for this crispr