ID: 1028326581

View in Genome Browser
Species Human (GRCh38)
Location 7:89534307-89534329
Sequence TAGAAAAATGAGGAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028326577_1028326581 -10 Left 1028326577 7:89534294-89534316 CCAGCTGAATTAATAGAAAAATG No data
Right 1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028326581 Original CRISPR TAGAAAAATGAGGAGGAGGC AGG Intergenic
No off target data available for this crispr