ID: 1028329265

View in Genome Browser
Species Human (GRCh38)
Location 7:89568479-89568501
Sequence CACAGCCAGCATCTTAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028329262_1028329265 -7 Left 1028329262 7:89568463-89568485 CCATCTATGACAAACCCACAGCC 0: 1000
1: 1970
2: 2218
3: 2137
4: 2093
Right 1028329265 7:89568479-89568501 CACAGCCAGCATCTTAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028329265 Original CRISPR CACAGCCAGCATCTTAATGA AGG Intergenic
No off target data available for this crispr