ID: 1028335640

View in Genome Browser
Species Human (GRCh38)
Location 7:89651190-89651212
Sequence GTGAATAAAAGGATGGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028335640_1028335643 -5 Left 1028335640 7:89651190-89651212 CCAAAGTCCATCCTTTTATTCAC No data
Right 1028335643 7:89651208-89651230 TTCACAGTTCACTCTGAATTAGG No data
1028335640_1028335644 7 Left 1028335640 7:89651190-89651212 CCAAAGTCCATCCTTTTATTCAC No data
Right 1028335644 7:89651220-89651242 TCTGAATTAGGAGATGTTATAGG No data
1028335640_1028335647 30 Left 1028335640 7:89651190-89651212 CCAAAGTCCATCCTTTTATTCAC No data
Right 1028335647 7:89651243-89651265 GATTCTAGAGAAATTGAGATGGG No data
1028335640_1028335646 29 Left 1028335640 7:89651190-89651212 CCAAAGTCCATCCTTTTATTCAC No data
Right 1028335646 7:89651242-89651264 GGATTCTAGAGAAATTGAGATGG No data
1028335640_1028335645 8 Left 1028335640 7:89651190-89651212 CCAAAGTCCATCCTTTTATTCAC No data
Right 1028335645 7:89651221-89651243 CTGAATTAGGAGATGTTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028335640 Original CRISPR GTGAATAAAAGGATGGACTT TGG (reversed) Intergenic
No off target data available for this crispr