ID: 1028338035

View in Genome Browser
Species Human (GRCh38)
Location 7:89681946-89681968
Sequence CTCTCAGGGCACCATGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028338035_1028338041 17 Left 1028338035 7:89681946-89681968 CCTTTCCCATGGTGCCCTGAGAG No data
Right 1028338041 7:89681986-89682008 GCACTTAGAATTGAATTATTAGG No data
1028338035_1028338040 -5 Left 1028338035 7:89681946-89681968 CCTTTCCCATGGTGCCCTGAGAG No data
Right 1028338040 7:89681964-89681986 GAGAGTTTATGAGCTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028338035 Original CRISPR CTCTCAGGGCACCATGGGAA AGG (reversed) Intergenic
No off target data available for this crispr