ID: 1028338471

View in Genome Browser
Species Human (GRCh38)
Location 7:89687825-89687847
Sequence AGTCAGGCTGAGAACCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028338468_1028338471 14 Left 1028338468 7:89687788-89687810 CCCAACTAACAGGTAGTGCTCAG No data
Right 1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG No data
1028338464_1028338471 29 Left 1028338464 7:89687773-89687795 CCAGAGGCCAAAGACCCCAACTA No data
Right 1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG No data
1028338469_1028338471 13 Left 1028338469 7:89687789-89687811 CCAACTAACAGGTAGTGCTCAGT No data
Right 1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG No data
1028338466_1028338471 22 Left 1028338466 7:89687780-89687802 CCAAAGACCCCAACTAACAGGTA No data
Right 1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG No data
1028338467_1028338471 15 Left 1028338467 7:89687787-89687809 CCCCAACTAACAGGTAGTGCTCA No data
Right 1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028338471 Original CRISPR AGTCAGGCTGAGAACCTCAG TGG Intergenic
No off target data available for this crispr