ID: 1028340493

View in Genome Browser
Species Human (GRCh38)
Location 7:89713370-89713392
Sequence ACTGCTCTAAATAGTATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028340493_1028340495 -6 Left 1028340493 7:89713370-89713392 CCTTTAATACTATTTAGAGCAGT No data
Right 1028340495 7:89713387-89713409 AGCAGTAGTACATAGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028340493 Original CRISPR ACTGCTCTAAATAGTATTAA AGG (reversed) Intergenic
No off target data available for this crispr