ID: 1028341153

View in Genome Browser
Species Human (GRCh38)
Location 7:89721047-89721069
Sequence GAAGAACAGAAACAATAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028341150_1028341153 6 Left 1028341150 7:89721018-89721040 CCTGACTGAATGCCATCTGGGTC No data
Right 1028341153 7:89721047-89721069 GAAGAACAGAAACAATAAATAGG No data
1028341152_1028341153 -6 Left 1028341152 7:89721030-89721052 CCATCTGGGTCAAGATGGAAGAA No data
Right 1028341153 7:89721047-89721069 GAAGAACAGAAACAATAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028341153 Original CRISPR GAAGAACAGAAACAATAAAT AGG Intergenic
No off target data available for this crispr