ID: 1028343259

View in Genome Browser
Species Human (GRCh38)
Location 7:89748329-89748351
Sequence CCTCAGGTTCTATTGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028343259_1028343270 27 Left 1028343259 7:89748329-89748351 CCAGCTGGCAATAGAACCTGAGG No data
Right 1028343270 7:89748379-89748401 GCTGTTGGGGGTAAACAGCATGG No data
1028343259_1028343262 -4 Left 1028343259 7:89748329-89748351 CCAGCTGGCAATAGAACCTGAGG No data
Right 1028343262 7:89748348-89748370 GAGGAGAACATAAAATGTATAGG No data
1028343259_1028343268 14 Left 1028343259 7:89748329-89748351 CCAGCTGGCAATAGAACCTGAGG No data
Right 1028343268 7:89748366-89748388 ATAGGGTGGGAGAGCTGTTGGGG No data
1028343259_1028343266 12 Left 1028343259 7:89748329-89748351 CCAGCTGGCAATAGAACCTGAGG No data
Right 1028343266 7:89748364-89748386 GTATAGGGTGGGAGAGCTGTTGG No data
1028343259_1028343269 15 Left 1028343259 7:89748329-89748351 CCAGCTGGCAATAGAACCTGAGG No data
Right 1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG No data
1028343259_1028343265 1 Left 1028343259 7:89748329-89748351 CCAGCTGGCAATAGAACCTGAGG No data
Right 1028343265 7:89748353-89748375 GAACATAAAATGTATAGGGTGGG No data
1028343259_1028343263 -3 Left 1028343259 7:89748329-89748351 CCAGCTGGCAATAGAACCTGAGG No data
Right 1028343263 7:89748349-89748371 AGGAGAACATAAAATGTATAGGG No data
1028343259_1028343267 13 Left 1028343259 7:89748329-89748351 CCAGCTGGCAATAGAACCTGAGG No data
Right 1028343267 7:89748365-89748387 TATAGGGTGGGAGAGCTGTTGGG No data
1028343259_1028343264 0 Left 1028343259 7:89748329-89748351 CCAGCTGGCAATAGAACCTGAGG No data
Right 1028343264 7:89748352-89748374 AGAACATAAAATGTATAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028343259 Original CRISPR CCTCAGGTTCTATTGCCAGC TGG (reversed) Intergenic
No off target data available for this crispr